sbuild (Debian sbuild) 0.89.3+deb13u4 (28 December 2025) on mjolnir.einval.org +==============================================================================+ | flexbar 1:3.5.0-7 (amd64) Fri, 20 Feb 2026 20:00:20 +0000 | +==============================================================================+ Package: flexbar Version: 1:3.5.0-7 Source Version: 1:3.5.0-7 Distribution: unstable Machine Architecture: arm64 Host Architecture: amd64 Build Architecture: arm64 Build Profiles: cross nocheck Build Type: any I: Unpacking /home/helmut/.cache/sbuild/unstable-arm64-sbuild.tar.zst to /tmp/tmp.sbuild.RDmJXaXBXn... I: Setting up the chroot... I: Creating chroot session... I: Setting up log color... I: Setting up apt archive... +------------------------------------------------------------------------------+ | Update chroot Fri, 20 Feb 2026 20:00:37 +0000 | +------------------------------------------------------------------------------+ Get:1 http://mirror.einval.org/debian unstable InRelease [187 kB] Get:2 http://mirror.einval.org/debian unstable/main Sources [11.3 MB] Get:3 http://mirror.einval.org/debian unstable/main amd64 Packages [10.2 MB] Get:4 http://mirror.einval.org/debian unstable/main arm64 Packages [10.1 MB] Fetched 31.7 MB in 7s (4323 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following packages will be upgraded: apt apt-utils binutils binutils-aarch64-linux-gnu binutils-common debconf libacl1 libapt-pkg7.0 libattr1 libbinutils libcap-ng0 libctf-nobfd0 libctf0 libgprofng0 libsframe3 linux-libc-dev tar zlib1g 18 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. Need to get 12.0 MB of archives. After this operation, 138 kB of additional disk space will be used. Get:1 http://mirror.einval.org/debian unstable/main arm64 tar arm64 1.35+dfsg-4 [802 kB] Get:2 http://mirror.einval.org/debian unstable/main arm64 zlib1g arm64 1:1.3.dfsg+really1.3.1-3 [85.9 kB] Get:3 http://mirror.einval.org/debian unstable/main arm64 libapt-pkg7.0 arm64 3.1.16 [1060 kB] Get:4 http://mirror.einval.org/debian unstable/main arm64 apt arm64 3.1.16 [1424 kB] Get:5 http://mirror.einval.org/debian unstable/main arm64 apt-utils arm64 3.1.16 [339 kB] Get:6 http://mirror.einval.org/debian unstable/main arm64 debconf all 1.5.92 [123 kB] Get:7 http://mirror.einval.org/debian unstable/main arm64 libacl1 arm64 2.3.2-3 [31.8 kB] Get:8 http://mirror.einval.org/debian unstable/main arm64 libattr1 arm64 1:2.5.2-4 [22.7 kB] Get:9 http://mirror.einval.org/debian unstable/main arm64 libcap-ng0 arm64 0.9.1-1 [17.3 kB] Get:10 http://mirror.einval.org/debian unstable/main arm64 libgprofng0 arm64 2.46-2 [680 kB] Get:11 http://mirror.einval.org/debian unstable/main arm64 libctf0 arm64 2.46-2 [86.1 kB] Get:12 http://mirror.einval.org/debian unstable/main arm64 libctf-nobfd0 arm64 2.46-2 [155 kB] Get:13 http://mirror.einval.org/debian unstable/main arm64 binutils-aarch64-linux-gnu arm64 2.46-2 [867 kB] Get:14 http://mirror.einval.org/debian unstable/main arm64 libbinutils arm64 2.46-2 [686 kB] Get:15 http://mirror.einval.org/debian unstable/main arm64 binutils arm64 2.46-2 [279 kB] Get:16 http://mirror.einval.org/debian unstable/main arm64 binutils-common arm64 2.46-2 [2635 kB] Get:17 http://mirror.einval.org/debian unstable/main arm64 libsframe3 arm64 2.46-2 [84.9 kB] Get:18 http://mirror.einval.org/debian unstable/main arm64 linux-libc-dev all 6.18.12-1 [2574 kB] Preconfiguring packages ... Fetched 12.0 MB in 0s (77.5 MB/s) (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12104 files and directories currently installed.) Preparing to unpack .../tar_1.35+dfsg-4_arm64.deb ... Unpacking tar (1.35+dfsg-4) over (1.35+dfsg-3.1+b1) ... Setting up tar (1.35+dfsg-4) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12103 files and directories currently installed.) Preparing to unpack .../zlib1g_1%3a1.3.dfsg+really1.3.1-3_arm64.deb ... Unpacking zlib1g:arm64 (1:1.3.dfsg+really1.3.1-3) over (1:1.3.dfsg+really1.3.1-2) ... Setting up zlib1g:arm64 (1:1.3.dfsg+really1.3.1-3) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12103 files and directories currently installed.) Preparing to unpack .../libapt-pkg7.0_3.1.16_arm64.deb ... Unpacking libapt-pkg7.0:arm64 (3.1.16) over (3.1.15) ... Setting up libapt-pkg7.0:arm64 (3.1.16) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12103 files and directories currently installed.) Preparing to unpack .../archives/apt_3.1.16_arm64.deb ... Unpacking apt (3.1.16) over (3.1.15) ... Setting up apt (3.1.16) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12106 files and directories currently installed.) Preparing to unpack .../apt-utils_3.1.16_arm64.deb ... Unpacking apt-utils (3.1.16) over (3.1.15) ... Preparing to unpack .../debconf_1.5.92_all.deb ... Unpacking debconf (1.5.92) over (1.5.91) ... Setting up debconf (1.5.92) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12108 files and directories currently installed.) Preparing to unpack .../libacl1_2.3.2-3_arm64.deb ... Unpacking libacl1:arm64 (2.3.2-3) over (2.3.2-2+b2) ... Setting up libacl1:arm64 (2.3.2-3) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12106 files and directories currently installed.) Preparing to unpack .../libattr1_1%3a2.5.2-4_arm64.deb ... Unpacking libattr1:arm64 (1:2.5.2-4) over (1:2.5.2-3+b1) ... Setting up libattr1:arm64 (1:2.5.2-4) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12105 files and directories currently installed.) Preparing to unpack .../libcap-ng0_0.9.1-1_arm64.deb ... Unpacking libcap-ng0:arm64 (0.9.1-1) over (0.8.5-4+b2) ... Setting up libcap-ng0:arm64 (0.9.1-1) ... (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 12104 files and directories currently installed.) Preparing to unpack .../0-libgprofng0_2.46-2_arm64.deb ... Unpacking libgprofng0:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../1-libctf0_2.46-2_arm64.deb ... Unpacking libctf0:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../2-libctf-nobfd0_2.46-2_arm64.deb ... Unpacking libctf-nobfd0:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../3-binutils-aarch64-linux-gnu_2.46-2_arm64.deb ... Unpacking binutils-aarch64-linux-gnu (2.46-2) over (2.46-1) ... Preparing to unpack .../4-libbinutils_2.46-2_arm64.deb ... Unpacking libbinutils:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../5-binutils_2.46-2_arm64.deb ... Unpacking binutils (2.46-2) over (2.46-1) ... Preparing to unpack .../6-binutils-common_2.46-2_arm64.deb ... Unpacking binutils-common:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../7-libsframe3_2.46-2_arm64.deb ... Unpacking libsframe3:arm64 (2.46-2) over (2.46-1) ... Preparing to unpack .../8-linux-libc-dev_6.18.12-1_all.deb ... Unpacking linux-libc-dev (6.18.12-1) over (6.18.10-1) ... Setting up apt-utils (3.1.16) ... Setting up binutils-common:arm64 (2.46-2) ... Setting up libsframe3:arm64 (2.46-2) ... Setting up linux-libc-dev (6.18.12-1) ... Setting up libctf-nobfd0:arm64 (2.46-2) ... Setting up libbinutils:arm64 (2.46-2) ... Setting up libctf0:arm64 (2.46-2) ... Setting up binutils-aarch64-linux-gnu (2.46-2) ... Setting up libgprofng0:arm64 (2.46-2) ... Setting up binutils (2.46-2) ... Processing triggers for libc-bin (2.42-13) ... +------------------------------------------------------------------------------+ | Fetch source files Fri, 20 Feb 2026 20:01:00 +0000 | +------------------------------------------------------------------------------+ Check APT --------- Checking available source versions... Download source files with APT ------------------------------ Reading package lists... NOTICE: 'flexbar' packaging is maintained in the 'Git' version control system at: https://salsa.debian.org/med-team/flexbar.git Please use: git clone https://salsa.debian.org/med-team/flexbar.git to retrieve the latest (possibly unreleased) updates to the package. Need to get 57.4 kB of source archives. Get:1 http://mirror.einval.org/debian unstable/main flexbar 1:3.5.0-7 (dsc) [2043 B] Get:2 http://mirror.einval.org/debian unstable/main flexbar 1:3.5.0-7 (tar) [44.0 kB] Get:3 http://mirror.einval.org/debian unstable/main flexbar 1:3.5.0-7 (diff) [11.3 kB] Fetched 57.4 kB in 0s (718 kB/s) Download complete and in download only mode +------------------------------------------------------------------------------+ | Install package build dependencies Fri, 20 Feb 2026 20:01:09 +0000 | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev, libc-dev, libstdc++-dev, build-essential:arm64, crossbuild-essential-amd64:arm64, apt-utils:arm64, libc-dev:amd64, libstdc++-dev:amd64 Filtered Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev, libc-dev, libstdc++-dev, build-essential:arm64, crossbuild-essential-amd64:arm64, apt-utils:arm64, libc-dev:amd64, libstdc++-dev:amd64 dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/build/reproducible-path/resolver-TgVwht/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ InRelease Get:2 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ Release [609 B] Ign:3 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ Release.gpg Get:4 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ Sources [773 B] Get:5 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ Packages [816 B] Fetched 2198 B in 0s (101 kB/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... Execute external solver... The following additional packages will be installed: autoconf automake autopoint autotools-dev binutils-x86-64-linux-gnu bsdextrautils cmake cmake-data cpp-15-x86-64-linux-gnu cpp-x86-64-linux-gnu crossbuild-essential-amd64 debhelper dh-autoreconf dh-strip-nondeterminism dwz file g++-15-x86-64-linux-gnu g++-x86-64-linux-gnu gcc-15-base:amd64 gcc-15-cross-base gcc-15-x86-64-linux-gnu gcc-15-x86-64-linux-gnu-base gcc-x86-64-linux-gnu gettext gettext-base groff-base intltool-debian libarchive-zip-perl libarchive13t64 libasan8:amd64 libasan8-amd64-cross libatomic1:amd64 libatomic1-amd64-cross libbrotli1 libbz2-1.0:amd64 libbz2-dev:amd64 libc-gconv-modules-extra:amd64 libc6:amd64 libc6-amd64-cross libc6-dev:amd64 libc6-dev-amd64-cross libcom-err2 libcurl4t64 libdebhelper-perl libelf1t64 libexpat1 libffi8 libfile-stripnondeterminism-perl libgcc-15-dev:amd64 libgcc-15-dev-amd64-cross libgcc-s1:amd64 libgcc-s1-amd64-cross libgnutls30t64 libgomp1:amd64 libgomp1-amd64-cross libgssapi-krb5-2 libhwasan0:amd64 libhwasan0-amd64-cross libhwloc15:amd64 libidn2-0 libitm1:amd64 libitm1-amd64-cross libjsoncpp26 libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 libldap2 liblsan0:amd64 liblsan0-amd64-cross libmagic-mgc libmagic1t64 libncursesw6 libnghttp2-14 libnghttp3-9 libngtcp2-16 libngtcp2-crypto-ossl0 libp11-kit0 libpipeline1 libproc2-0 libpsl5t64 libquadmath0:amd64 libquadmath0-amd64-cross librhash1 librtmp1 libsasl2-2 libsasl2-modules-db libseqan2-dev libssh2-1t64 libstdc++-15-dev:amd64 libstdc++-15-dev-amd64-cross libstdc++6:amd64 libstdc++6-amd64-cross libtasn1-6 libtbb-dev:amd64 libtbb12:amd64 libtbbbind-2-5:amd64 libtbbmalloc2:amd64 libtool libtsan2:amd64 libtsan2-amd64-cross libubsan1:amd64 libubsan1-amd64-cross libuchardet0 libudev1:amd64 libunistring5 libuv1t64 libxml2-16 linux-libc-dev-amd64-cross m4 man-db po-debconf procps sensible-utils zlib1g:amd64 zlib1g-dev:amd64 Suggested packages: autoconf-archive gnu-standards autoconf-doc binutils-doc cmake-doc cmake-format elpa-cmake-mode ninja-build gcc-15-locales cpp-15-doc cpp-doc dh-make gcc-15-doc manpages-dev flex bison gdb-x86-64-linux-gnu gcc-doc gettext-doc libasprintf-dev libgettextpo-dev gnulib-l10n groff lrzip glibc-doc:amd64 libc-l10n:amd64 locales:amd64 libnss-nis:amd64 libnss-nisplus:amd64 manpages-dev:amd64 gnutls-bin krb5-doc krb5-user libhwloc-contrib-plugins:amd64 libstdc++-15-doc:amd64 libtbb-doc:amd64 libtool-doc gfortran | fortran95-compiler m4-doc apparmor less www-browser libmail-box-perl Recommended packages: curl | wget | lynx bzip2-doc:amd64 libidn2-0:amd64 ca-certificates libarchive-cpio-perl libhwloc-plugins:amd64 krb5-locales libldap-common libgpm2 publicsuffix libsasl2-modules libltdl-dev libmail-sendmail-perl psmisc linux-sysctl-defaults The following NEW packages will be installed: autoconf automake autopoint autotools-dev binutils-x86-64-linux-gnu bsdextrautils cmake cmake-data cpp-15-x86-64-linux-gnu cpp-x86-64-linux-gnu crossbuild-essential-amd64 debhelper dh-autoreconf dh-strip-nondeterminism dwz file g++-15-x86-64-linux-gnu g++-x86-64-linux-gnu gcc-15-base:amd64 gcc-15-cross-base gcc-15-x86-64-linux-gnu gcc-15-x86-64-linux-gnu-base gcc-x86-64-linux-gnu gettext gettext-base groff-base intltool-debian libarchive-zip-perl libarchive13t64 libasan8:amd64 libasan8-amd64-cross libatomic1:amd64 libatomic1-amd64-cross libbrotli1 libbz2-1.0:amd64 libbz2-dev:amd64 libc-gconv-modules-extra:amd64 libc6:amd64 libc6-amd64-cross libc6-dev:amd64 libc6-dev-amd64-cross libcom-err2 libcurl4t64 libdebhelper-perl libelf1t64 libexpat1 libffi8 libfile-stripnondeterminism-perl libgcc-15-dev:amd64 libgcc-15-dev-amd64-cross libgcc-s1:amd64 libgcc-s1-amd64-cross libgnutls30t64 libgomp1:amd64 libgomp1-amd64-cross libgssapi-krb5-2 libhwasan0:amd64 libhwasan0-amd64-cross libhwloc15:amd64 libidn2-0 libitm1:amd64 libitm1-amd64-cross libjsoncpp26 libk5crypto3 libkeyutils1 libkrb5-3 libkrb5support0 libldap2 liblsan0:amd64 liblsan0-amd64-cross libmagic-mgc libmagic1t64 libncursesw6 libnghttp2-14 libnghttp3-9 libngtcp2-16 libngtcp2-crypto-ossl0 libp11-kit0 libpipeline1 libproc2-0 libpsl5t64 libquadmath0:amd64 libquadmath0-amd64-cross librhash1 librtmp1 libsasl2-2 libsasl2-modules-db libseqan2-dev libssh2-1t64 libstdc++-15-dev:amd64 libstdc++-15-dev-amd64-cross libstdc++6:amd64 libstdc++6-amd64-cross libtasn1-6 libtbb-dev:amd64 libtbb12:amd64 libtbbbind-2-5:amd64 libtbbmalloc2:amd64 libtool libtsan2:amd64 libtsan2-amd64-cross libubsan1:amd64 libubsan1-amd64-cross libuchardet0 libudev1:amd64 libunistring5 libuv1t64 libxml2-16 linux-libc-dev-amd64-cross m4 man-db po-debconf procps sbuild-build-depends-main-dummy:amd64 sensible-utils zlib1g:amd64 zlib1g-dev:amd64 0 upgraded, 117 newly installed, 0 to remove and 0 not upgraded. Need to get 120 MB of archives. After this operation, 498 MB of additional disk space will be used. Get:1 copy:/build/reproducible-path/resolver-TgVwht/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [928 B] Get:2 http://mirror.einval.org/debian unstable/main arm64 libexpat1 arm64 2.7.4-1 [101 kB] Get:3 http://mirror.einval.org/debian unstable/main arm64 libncursesw6 arm64 6.6+20251231-1 [125 kB] Get:4 http://mirror.einval.org/debian unstable/main arm64 libproc2-0 arm64 2:4.0.4-9+b1 [62.4 kB] Get:5 http://mirror.einval.org/debian unstable/main arm64 procps arm64 2:4.0.4-9+b1 [871 kB] Get:6 http://mirror.einval.org/debian unstable/main arm64 sensible-utils all 0.0.26 [27.0 kB] Get:7 http://mirror.einval.org/debian unstable/main arm64 libmagic-mgc arm64 1:5.46-5+b1 [338 kB] Get:8 http://mirror.einval.org/debian unstable/main arm64 libmagic1t64 arm64 1:5.46-5+b1 [103 kB] Get:9 http://mirror.einval.org/debian unstable/main arm64 file arm64 1:5.46-5+b1 [44.0 kB] Get:10 http://mirror.einval.org/debian unstable/main arm64 gettext-base arm64 0.23.2-1 [242 kB] Get:11 http://mirror.einval.org/debian unstable/main arm64 libuchardet0 arm64 0.0.8-2+b1 [69.1 kB] Get:12 http://mirror.einval.org/debian unstable/main arm64 groff-base arm64 1.23.0-10+b1 [1133 kB] Get:13 http://mirror.einval.org/debian unstable/main arm64 bsdextrautils arm64 2.41.3-3 [97.7 kB] Get:14 http://mirror.einval.org/debian unstable/main arm64 libpipeline1 arm64 1.5.8-2 [40.3 kB] Get:15 http://mirror.einval.org/debian unstable/main arm64 man-db arm64 2.13.1-1+b1 [1455 kB] Get:16 http://mirror.einval.org/debian unstable/main arm64 m4 arm64 1.4.21-1 [323 kB] Get:17 http://mirror.einval.org/debian unstable/main arm64 autoconf all 2.72-3.1 [494 kB] Get:18 http://mirror.einval.org/debian unstable/main arm64 autotools-dev all 20240727.1 [60.2 kB] Get:19 http://mirror.einval.org/debian unstable/main arm64 automake all 1:1.18.1-3 [878 kB] Get:20 http://mirror.einval.org/debian unstable/main arm64 autopoint all 0.23.2-1 [772 kB] Get:21 http://mirror.einval.org/debian unstable/main arm64 cmake-data all 4.2.3-2 [2556 kB] Get:22 http://mirror.einval.org/debian unstable/main arm64 libxml2-16 arm64 2.15.1+dfsg-2+b1 [591 kB] Get:23 http://mirror.einval.org/debian unstable/main arm64 libarchive13t64 arm64 3.8.5-1 [329 kB] Get:24 http://mirror.einval.org/debian unstable/main arm64 libnghttp3-9 arm64 1.12.0-1 [63.6 kB] Get:25 http://mirror.einval.org/debian unstable/main arm64 libngtcp2-16 arm64 1.16.0-1 [123 kB] Get:26 http://mirror.einval.org/debian unstable/main arm64 libbrotli1 arm64 1.2.0-3 [295 kB] Get:27 http://mirror.einval.org/debian unstable/main arm64 libkrb5support0 arm64 1.22.1-2 [32.2 kB] Get:28 http://mirror.einval.org/debian unstable/main arm64 libcom-err2 arm64 1.47.2-3+b8 [24.9 kB] Get:29 http://mirror.einval.org/debian unstable/main arm64 libk5crypto3 arm64 1.22.1-2 [77.1 kB] Get:30 http://mirror.einval.org/debian unstable/main arm64 libkeyutils1 arm64 1.6.3-6+b1 [9852 B] Get:31 http://mirror.einval.org/debian unstable/main arm64 libkrb5-3 arm64 1.22.1-2 [315 kB] Get:32 http://mirror.einval.org/debian unstable/main arm64 libgssapi-krb5-2 arm64 1.22.1-2 [127 kB] Get:33 http://mirror.einval.org/debian unstable/main arm64 libunistring5 arm64 1.3-2+b1 [459 kB] Get:34 http://mirror.einval.org/debian unstable/main arm64 libidn2-0 arm64 2.3.8-4+b1 [108 kB] Get:35 http://mirror.einval.org/debian unstable/main arm64 libsasl2-modules-db arm64 2.1.28+dfsg1-10 [19.8 kB] Get:36 http://mirror.einval.org/debian unstable/main arm64 libsasl2-2 arm64 2.1.28+dfsg1-10 [55.0 kB] Get:37 http://mirror.einval.org/debian unstable/main arm64 libldap2 arm64 2.6.10+dfsg-1+b1 [179 kB] Get:38 http://mirror.einval.org/debian unstable/main arm64 libnghttp2-14 arm64 1.68.0-1 [74.6 kB] Get:39 http://mirror.einval.org/debian unstable/main arm64 libngtcp2-crypto-ossl0 arm64 1.16.0-1 [25.7 kB] Get:40 http://mirror.einval.org/debian unstable/main arm64 libpsl5t64 arm64 0.21.2-1.1+b2 [59.6 kB] Get:41 http://mirror.einval.org/debian unstable/main arm64 libffi8 arm64 3.5.2-3+b1 [23.3 kB] Get:42 http://mirror.einval.org/debian unstable/main arm64 libp11-kit0 arm64 0.25.10-1+b1 [421 kB] Get:43 http://mirror.einval.org/debian unstable/main arm64 libtasn1-6 arm64 4.21.0-2 [48.0 kB] Get:44 http://mirror.einval.org/debian unstable/main arm64 libgnutls30t64 arm64 3.8.12-2 [1407 kB] Get:45 http://mirror.einval.org/debian unstable/main arm64 librtmp1 arm64 2.4+20151223.gitfa8646d.1-3+b1 [57.7 kB] Get:46 http://mirror.einval.org/debian unstable/main arm64 libssh2-1t64 arm64 1.11.1-1+b1 [235 kB] Get:47 http://mirror.einval.org/debian unstable/main arm64 libcurl4t64 arm64 8.18.0-2 [373 kB] Get:48 http://mirror.einval.org/debian unstable/main arm64 libjsoncpp26 arm64 1.9.6-5 [72.4 kB] Get:49 http://mirror.einval.org/debian unstable/main arm64 librhash1 arm64 1.4.6-1.1 [128 kB] Get:50 http://mirror.einval.org/debian unstable/main arm64 libuv1t64 arm64 1.51.0-2+b1 [149 kB] Get:51 http://mirror.einval.org/debian unstable/main arm64 cmake arm64 4.2.3-2 [10.7 MB] Get:52 http://mirror.einval.org/debian unstable/main arm64 gcc-15-x86-64-linux-gnu-base arm64 15.2.0-13cross1 [55.0 kB] Get:53 http://mirror.einval.org/debian unstable/main arm64 cpp-15-x86-64-linux-gnu arm64 15.2.0-13cross1 [11.3 MB] Get:54 http://mirror.einval.org/debian unstable/main arm64 cpp-x86-64-linux-gnu arm64 4:15.2.0-5 [5324 B] Get:55 http://mirror.einval.org/debian unstable/main arm64 binutils-x86-64-linux-gnu arm64 2.46-2 [1534 kB] Get:56 http://mirror.einval.org/debian unstable/main arm64 gcc-15-cross-base all 15.2.0-13cross1 [50.4 kB] Get:57 http://mirror.einval.org/debian unstable/main arm64 libgcc-s1-amd64-cross all 15.2.0-13cross1 [71.6 kB] Get:58 http://mirror.einval.org/debian unstable/main arm64 libgomp1-amd64-cross all 15.2.0-13cross1 [132 kB] Get:59 http://mirror.einval.org/debian unstable/main arm64 libitm1-amd64-cross all 15.2.0-13cross1 [25.9 kB] Get:60 http://mirror.einval.org/debian unstable/main arm64 libatomic1-amd64-cross all 15.2.0-13cross1 [9244 B] Get:61 http://mirror.einval.org/debian unstable/main arm64 libasan8-amd64-cross all 15.2.0-13cross1 [2770 kB] Get:62 http://mirror.einval.org/debian unstable/main arm64 liblsan0-amd64-cross all 15.2.0-13cross1 [1248 kB] Get:63 http://mirror.einval.org/debian unstable/main arm64 libtsan2-amd64-cross all 15.2.0-13cross1 [2480 kB] Get:64 http://mirror.einval.org/debian unstable/main arm64 libc6-amd64-cross all 2.42-12cross1 [1577 kB] Get:65 http://mirror.einval.org/debian unstable/main arm64 libstdc++6-amd64-cross all 15.2.0-13cross1 [689 kB] Get:66 http://mirror.einval.org/debian unstable/main arm64 libubsan1-amd64-cross all 15.2.0-13cross1 [1107 kB] Get:67 http://mirror.einval.org/debian unstable/main arm64 libhwasan0-amd64-cross all 15.2.0-13cross1 [1533 kB] Get:68 http://mirror.einval.org/debian unstable/main arm64 libquadmath0-amd64-cross all 15.2.0-13cross1 [145 kB] Get:69 http://mirror.einval.org/debian unstable/main arm64 libgcc-15-dev-amd64-cross all 15.2.0-13cross1 [2706 kB] Get:70 http://mirror.einval.org/debian unstable/main arm64 gcc-15-x86-64-linux-gnu arm64 15.2.0-13cross1 [21.8 MB] Get:71 http://mirror.einval.org/debian unstable/main arm64 gcc-x86-64-linux-gnu arm64 4:15.2.0-5 [1448 B] Get:72 http://mirror.einval.org/debian unstable/main arm64 linux-libc-dev-amd64-cross all 6.18.12-1 [12.2 kB] Get:73 http://mirror.einval.org/debian unstable/main arm64 libc6-dev-amd64-cross all 2.42-12cross1 [2010 kB] Get:74 http://mirror.einval.org/debian unstable/main arm64 libstdc++-15-dev-amd64-cross all 15.2.0-13cross1 [2426 kB] Get:75 http://mirror.einval.org/debian unstable/main arm64 g++-15-x86-64-linux-gnu arm64 15.2.0-13cross1 [12.2 MB] Get:76 http://mirror.einval.org/debian unstable/main arm64 g++-x86-64-linux-gnu arm64 4:15.2.0-5 [1204 B] Get:77 http://mirror.einval.org/debian unstable/main arm64 crossbuild-essential-amd64 all 12.12 [3552 B] Get:78 http://mirror.einval.org/debian unstable/main arm64 libdebhelper-perl all 13.30 [92.7 kB] Get:79 http://mirror.einval.org/debian unstable/main arm64 libtool all 2.5.4-9 [540 kB] Get:80 http://mirror.einval.org/debian unstable/main arm64 dh-autoreconf all 21+nmu1 [11.7 kB] Get:81 http://mirror.einval.org/debian unstable/main arm64 libarchive-zip-perl all 1.68-1 [104 kB] Get:82 http://mirror.einval.org/debian unstable/main arm64 libfile-stripnondeterminism-perl all 1.15.0-1 [19.9 kB] Get:83 http://mirror.einval.org/debian unstable/main arm64 dh-strip-nondeterminism all 1.15.0-1 [8812 B] Get:84 http://mirror.einval.org/debian unstable/main arm64 libelf1t64 arm64 0.194-1 [184 kB] Get:85 http://mirror.einval.org/debian unstable/main arm64 dwz arm64 0.16-2+b1 [100 kB] Get:86 http://mirror.einval.org/debian unstable/main arm64 gettext arm64 0.23.2-1 [1613 kB] Get:87 http://mirror.einval.org/debian unstable/main arm64 intltool-debian all 0.35.0+20060710.6 [22.9 kB] Get:88 http://mirror.einval.org/debian unstable/main arm64 po-debconf all 1.0.22 [216 kB] Get:89 http://mirror.einval.org/debian unstable/main arm64 debhelper all 13.30 [942 kB] Get:90 http://mirror.einval.org/debian unstable/main amd64 gcc-15-base amd64 15.2.0-13 [54.8 kB] Get:91 http://mirror.einval.org/debian unstable/main amd64 libgcc-s1 amd64 15.2.0-13 [71.5 kB] Get:92 http://mirror.einval.org/debian unstable/main amd64 libc-gconv-modules-extra amd64 2.42-13 [1123 kB] Get:93 http://mirror.einval.org/debian unstable/main amd64 libc6 amd64 2.42-13 [1814 kB] Get:94 http://mirror.einval.org/debian unstable/main amd64 libasan8 amd64 15.2.0-13 [2779 kB] Get:95 http://mirror.einval.org/debian unstable/main amd64 libatomic1 amd64 15.2.0-13 [9492 B] Get:96 http://mirror.einval.org/debian unstable/main amd64 libbz2-1.0 amd64 1.0.8-6+b1 [40.4 kB] Get:97 http://mirror.einval.org/debian unstable/main amd64 libc6-dev amd64 2.42-13 [2016 kB] Get:98 http://mirror.einval.org/debian unstable/main amd64 libbz2-dev amd64 1.0.8-6+b1 [33.6 kB] Get:99 http://mirror.einval.org/debian unstable/main amd64 libgomp1 amd64 15.2.0-13 [141 kB] Get:100 http://mirror.einval.org/debian unstable/main amd64 libitm1 amd64 15.2.0-13 [26.5 kB] Get:101 http://mirror.einval.org/debian unstable/main amd64 liblsan0 amd64 15.2.0-13 [1249 kB] Get:102 http://mirror.einval.org/debian unstable/main amd64 libtsan2 amd64 15.2.0-13 [2491 kB] Get:103 http://mirror.einval.org/debian unstable/main amd64 libstdc++6 amd64 15.2.0-13 [737 kB] Get:104 http://mirror.einval.org/debian unstable/main amd64 libubsan1 amd64 15.2.0-13 [1108 kB] Get:105 http://mirror.einval.org/debian unstable/main amd64 libhwasan0 amd64 15.2.0-13 [1538 kB] Get:106 http://mirror.einval.org/debian unstable/main amd64 libquadmath0 amd64 15.2.0-13 [145 kB] Get:107 http://mirror.einval.org/debian unstable/main amd64 libgcc-15-dev amd64 15.2.0-13 [2719 kB] Get:108 http://mirror.einval.org/debian unstable/main amd64 libudev1 amd64 259.1-1 [158 kB] Get:109 http://mirror.einval.org/debian unstable/main amd64 libhwloc15 amd64 2.13.0-2 [165 kB] Get:110 http://mirror.einval.org/debian unstable/main arm64 libseqan2-dev all 2.5.2-1 [1224 kB] Get:111 http://mirror.einval.org/debian unstable/main amd64 libstdc++-15-dev amd64 15.2.0-13 [2446 kB] Get:112 http://mirror.einval.org/debian unstable/main amd64 libtbbbind-2-5 amd64 2022.3.0-2 [14.6 kB] Get:113 http://mirror.einval.org/debian unstable/main amd64 libtbbmalloc2 amd64 2022.3.0-2 [51.0 kB] Get:114 http://mirror.einval.org/debian unstable/main amd64 libtbb12 amd64 2022.3.0-2 [97.8 kB] Get:115 http://mirror.einval.org/debian unstable/main amd64 libtbb-dev amd64 2022.3.0-2 [204 kB] Get:116 http://mirror.einval.org/debian unstable/main amd64 zlib1g amd64 1:1.3.dfsg+really1.3.1-3 [89.0 kB] Get:117 http://mirror.einval.org/debian unstable/main amd64 zlib1g-dev amd64 1:1.3.dfsg+really1.3.1-3 [919 kB] Preconfiguring packages ... Fetched 120 MB in 1s (94.1 MB/s) Selecting previously unselected package libexpat1:arm64. (Reading database ... 12104 files and directories currently installed.) Preparing to unpack .../000-libexpat1_2.7.4-1_arm64.deb ... Unpacking libexpat1:arm64 (2.7.4-1) ... Selecting previously unselected package libncursesw6:arm64. Preparing to unpack .../001-libncursesw6_6.6+20251231-1_arm64.deb ... Unpacking libncursesw6:arm64 (6.6+20251231-1) ... Selecting previously unselected package libproc2-0:arm64. Preparing to unpack .../002-libproc2-0_2%3a4.0.4-9+b1_arm64.deb ... Unpacking libproc2-0:arm64 (2:4.0.4-9+b1) ... Selecting previously unselected package procps. Preparing to unpack .../003-procps_2%3a4.0.4-9+b1_arm64.deb ... Unpacking procps (2:4.0.4-9+b1) ... Selecting previously unselected package sensible-utils. Preparing to unpack .../004-sensible-utils_0.0.26_all.deb ... Unpacking sensible-utils (0.0.26) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../005-libmagic-mgc_1%3a5.46-5+b1_arm64.deb ... Unpacking libmagic-mgc (1:5.46-5+b1) ... Selecting previously unselected package libmagic1t64:arm64. Preparing to unpack .../006-libmagic1t64_1%3a5.46-5+b1_arm64.deb ... Unpacking libmagic1t64:arm64 (1:5.46-5+b1) ... Selecting previously unselected package file. Preparing to unpack .../007-file_1%3a5.46-5+b1_arm64.deb ... Unpacking file (1:5.46-5+b1) ... Selecting previously unselected package gettext-base. Preparing to unpack .../008-gettext-base_0.23.2-1_arm64.deb ... Unpacking gettext-base (0.23.2-1) ... Selecting previously unselected package libuchardet0:arm64. Preparing to unpack .../009-libuchardet0_0.0.8-2+b1_arm64.deb ... Unpacking libuchardet0:arm64 (0.0.8-2+b1) ... Selecting previously unselected package groff-base. Preparing to unpack .../010-groff-base_1.23.0-10+b1_arm64.deb ... Unpacking groff-base (1.23.0-10+b1) ... Selecting previously unselected package bsdextrautils. Preparing to unpack .../011-bsdextrautils_2.41.3-3_arm64.deb ... Unpacking bsdextrautils (2.41.3-3) ... Selecting previously unselected package libpipeline1:arm64. Preparing to unpack .../012-libpipeline1_1.5.8-2_arm64.deb ... Unpacking libpipeline1:arm64 (1.5.8-2) ... Selecting previously unselected package man-db. Preparing to unpack .../013-man-db_2.13.1-1+b1_arm64.deb ... Unpacking man-db (2.13.1-1+b1) ... Selecting previously unselected package m4. Preparing to unpack .../014-m4_1.4.21-1_arm64.deb ... Unpacking m4 (1.4.21-1) ... Selecting previously unselected package autoconf. Preparing to unpack .../015-autoconf_2.72-3.1_all.deb ... Unpacking autoconf (2.72-3.1) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../016-autotools-dev_20240727.1_all.deb ... Unpacking autotools-dev (20240727.1) ... Selecting previously unselected package automake. Preparing to unpack .../017-automake_1%3a1.18.1-3_all.deb ... Unpacking automake (1:1.18.1-3) ... Selecting previously unselected package autopoint. Preparing to unpack .../018-autopoint_0.23.2-1_all.deb ... Unpacking autopoint (0.23.2-1) ... Selecting previously unselected package cmake-data. Preparing to unpack .../019-cmake-data_4.2.3-2_all.deb ... Unpacking cmake-data (4.2.3-2) ... Selecting previously unselected package libxml2-16:arm64. Preparing to unpack .../020-libxml2-16_2.15.1+dfsg-2+b1_arm64.deb ... Unpacking libxml2-16:arm64 (2.15.1+dfsg-2+b1) ... Selecting previously unselected package libarchive13t64:arm64. Preparing to unpack .../021-libarchive13t64_3.8.5-1_arm64.deb ... Unpacking libarchive13t64:arm64 (3.8.5-1) ... Selecting previously unselected package libnghttp3-9:arm64. Preparing to unpack .../022-libnghttp3-9_1.12.0-1_arm64.deb ... Unpacking libnghttp3-9:arm64 (1.12.0-1) ... Selecting previously unselected package libngtcp2-16:arm64. Preparing to unpack .../023-libngtcp2-16_1.16.0-1_arm64.deb ... Unpacking libngtcp2-16:arm64 (1.16.0-1) ... Selecting previously unselected package libbrotli1:arm64. Preparing to unpack .../024-libbrotli1_1.2.0-3_arm64.deb ... Unpacking libbrotli1:arm64 (1.2.0-3) ... Selecting previously unselected package libkrb5support0:arm64. Preparing to unpack .../025-libkrb5support0_1.22.1-2_arm64.deb ... Unpacking libkrb5support0:arm64 (1.22.1-2) ... Selecting previously unselected package libcom-err2:arm64. Preparing to unpack .../026-libcom-err2_1.47.2-3+b8_arm64.deb ... Unpacking libcom-err2:arm64 (1.47.2-3+b8) ... Selecting previously unselected package libk5crypto3:arm64. Preparing to unpack .../027-libk5crypto3_1.22.1-2_arm64.deb ... Unpacking libk5crypto3:arm64 (1.22.1-2) ... Selecting previously unselected package libkeyutils1:arm64. Preparing to unpack .../028-libkeyutils1_1.6.3-6+b1_arm64.deb ... Unpacking libkeyutils1:arm64 (1.6.3-6+b1) ... Selecting previously unselected package libkrb5-3:arm64. Preparing to unpack .../029-libkrb5-3_1.22.1-2_arm64.deb ... Unpacking libkrb5-3:arm64 (1.22.1-2) ... Selecting previously unselected package libgssapi-krb5-2:arm64. Preparing to unpack .../030-libgssapi-krb5-2_1.22.1-2_arm64.deb ... Unpacking libgssapi-krb5-2:arm64 (1.22.1-2) ... Selecting previously unselected package libunistring5:arm64. Preparing to unpack .../031-libunistring5_1.3-2+b1_arm64.deb ... Unpacking libunistring5:arm64 (1.3-2+b1) ... Selecting previously unselected package libidn2-0:arm64. Preparing to unpack .../032-libidn2-0_2.3.8-4+b1_arm64.deb ... Unpacking libidn2-0:arm64 (2.3.8-4+b1) ... Selecting previously unselected package libsasl2-modules-db:arm64. Preparing to unpack .../033-libsasl2-modules-db_2.1.28+dfsg1-10_arm64.deb ... Unpacking libsasl2-modules-db:arm64 (2.1.28+dfsg1-10) ... Selecting previously unselected package libsasl2-2:arm64. Preparing to unpack .../034-libsasl2-2_2.1.28+dfsg1-10_arm64.deb ... Unpacking libsasl2-2:arm64 (2.1.28+dfsg1-10) ... Selecting previously unselected package libldap2:arm64. Preparing to unpack .../035-libldap2_2.6.10+dfsg-1+b1_arm64.deb ... Unpacking libldap2:arm64 (2.6.10+dfsg-1+b1) ... Selecting previously unselected package libnghttp2-14:arm64. Preparing to unpack .../036-libnghttp2-14_1.68.0-1_arm64.deb ... Unpacking libnghttp2-14:arm64 (1.68.0-1) ... Selecting previously unselected package libngtcp2-crypto-ossl0:arm64. Preparing to unpack .../037-libngtcp2-crypto-ossl0_1.16.0-1_arm64.deb ... Unpacking libngtcp2-crypto-ossl0:arm64 (1.16.0-1) ... Selecting previously unselected package libpsl5t64:arm64. Preparing to unpack .../038-libpsl5t64_0.21.2-1.1+b2_arm64.deb ... Unpacking libpsl5t64:arm64 (0.21.2-1.1+b2) ... Selecting previously unselected package libffi8:arm64. Preparing to unpack .../039-libffi8_3.5.2-3+b1_arm64.deb ... Unpacking libffi8:arm64 (3.5.2-3+b1) ... Selecting previously unselected package libp11-kit0:arm64. Preparing to unpack .../040-libp11-kit0_0.25.10-1+b1_arm64.deb ... Unpacking libp11-kit0:arm64 (0.25.10-1+b1) ... Selecting previously unselected package libtasn1-6:arm64. Preparing to unpack .../041-libtasn1-6_4.21.0-2_arm64.deb ... Unpacking libtasn1-6:arm64 (4.21.0-2) ... Selecting previously unselected package libgnutls30t64:arm64. Preparing to unpack .../042-libgnutls30t64_3.8.12-2_arm64.deb ... Unpacking libgnutls30t64:arm64 (3.8.12-2) ... Selecting previously unselected package librtmp1:arm64. Preparing to unpack .../043-librtmp1_2.4+20151223.gitfa8646d.1-3+b1_arm64.deb ... Unpacking librtmp1:arm64 (2.4+20151223.gitfa8646d.1-3+b1) ... Selecting previously unselected package libssh2-1t64:arm64. Preparing to unpack .../044-libssh2-1t64_1.11.1-1+b1_arm64.deb ... Unpacking libssh2-1t64:arm64 (1.11.1-1+b1) ... Selecting previously unselected package libcurl4t64:arm64. Preparing to unpack .../045-libcurl4t64_8.18.0-2_arm64.deb ... Unpacking libcurl4t64:arm64 (8.18.0-2) ... Selecting previously unselected package libjsoncpp26:arm64. Preparing to unpack .../046-libjsoncpp26_1.9.6-5_arm64.deb ... Unpacking libjsoncpp26:arm64 (1.9.6-5) ... Selecting previously unselected package librhash1:arm64. Preparing to unpack .../047-librhash1_1.4.6-1.1_arm64.deb ... Unpacking librhash1:arm64 (1.4.6-1.1) ... Selecting previously unselected package libuv1t64:arm64. Preparing to unpack .../048-libuv1t64_1.51.0-2+b1_arm64.deb ... Unpacking libuv1t64:arm64 (1.51.0-2+b1) ... Selecting previously unselected package cmake. Preparing to unpack .../049-cmake_4.2.3-2_arm64.deb ... Unpacking cmake (4.2.3-2) ... Selecting previously unselected package gcc-15-x86-64-linux-gnu-base:arm64. Preparing to unpack .../050-gcc-15-x86-64-linux-gnu-base_15.2.0-13cross1_arm64.deb ... Unpacking gcc-15-x86-64-linux-gnu-base:arm64 (15.2.0-13cross1) ... Selecting previously unselected package cpp-15-x86-64-linux-gnu. Preparing to unpack .../051-cpp-15-x86-64-linux-gnu_15.2.0-13cross1_arm64.deb ... Unpacking cpp-15-x86-64-linux-gnu (15.2.0-13cross1) ... Selecting previously unselected package cpp-x86-64-linux-gnu. Preparing to unpack .../052-cpp-x86-64-linux-gnu_4%3a15.2.0-5_arm64.deb ... Unpacking cpp-x86-64-linux-gnu (4:15.2.0-5) ... Selecting previously unselected package binutils-x86-64-linux-gnu. Preparing to unpack .../053-binutils-x86-64-linux-gnu_2.46-2_arm64.deb ... Unpacking binutils-x86-64-linux-gnu (2.46-2) ... Selecting previously unselected package gcc-15-cross-base. Preparing to unpack .../054-gcc-15-cross-base_15.2.0-13cross1_all.deb ... Unpacking gcc-15-cross-base (15.2.0-13cross1) ... Selecting previously unselected package libgcc-s1-amd64-cross. Preparing to unpack .../055-libgcc-s1-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libgcc-s1-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libgomp1-amd64-cross. Preparing to unpack .../056-libgomp1-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libgomp1-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libitm1-amd64-cross. Preparing to unpack .../057-libitm1-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libitm1-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libatomic1-amd64-cross. Preparing to unpack .../058-libatomic1-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libatomic1-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libasan8-amd64-cross. Preparing to unpack .../059-libasan8-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libasan8-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package liblsan0-amd64-cross. Preparing to unpack .../060-liblsan0-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking liblsan0-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libtsan2-amd64-cross. Preparing to unpack .../061-libtsan2-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libtsan2-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libc6-amd64-cross. Preparing to unpack .../062-libc6-amd64-cross_2.42-12cross1_all.deb ... Unpacking libc6-amd64-cross (2.42-12cross1) ... Selecting previously unselected package libstdc++6-amd64-cross. Preparing to unpack .../063-libstdc++6-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libstdc++6-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libubsan1-amd64-cross. Preparing to unpack .../064-libubsan1-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libubsan1-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libhwasan0-amd64-cross. Preparing to unpack .../065-libhwasan0-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libhwasan0-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libquadmath0-amd64-cross. Preparing to unpack .../066-libquadmath0-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libquadmath0-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package libgcc-15-dev-amd64-cross. Preparing to unpack .../067-libgcc-15-dev-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libgcc-15-dev-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package gcc-15-x86-64-linux-gnu. Preparing to unpack .../068-gcc-15-x86-64-linux-gnu_15.2.0-13cross1_arm64.deb ... Unpacking gcc-15-x86-64-linux-gnu (15.2.0-13cross1) ... Selecting previously unselected package gcc-x86-64-linux-gnu. Preparing to unpack .../069-gcc-x86-64-linux-gnu_4%3a15.2.0-5_arm64.deb ... Unpacking gcc-x86-64-linux-gnu (4:15.2.0-5) ... Selecting previously unselected package linux-libc-dev-amd64-cross. Preparing to unpack .../070-linux-libc-dev-amd64-cross_6.18.12-1_all.deb ... Unpacking linux-libc-dev-amd64-cross (6.18.12-1) ... Selecting previously unselected package libc6-dev-amd64-cross. Preparing to unpack .../071-libc6-dev-amd64-cross_2.42-12cross1_all.deb ... Unpacking libc6-dev-amd64-cross (2.42-12cross1) ... Selecting previously unselected package libstdc++-15-dev-amd64-cross. Preparing to unpack .../072-libstdc++-15-dev-amd64-cross_15.2.0-13cross1_all.deb ... Unpacking libstdc++-15-dev-amd64-cross (15.2.0-13cross1) ... Selecting previously unselected package g++-15-x86-64-linux-gnu. Preparing to unpack .../073-g++-15-x86-64-linux-gnu_15.2.0-13cross1_arm64.deb ... Unpacking g++-15-x86-64-linux-gnu (15.2.0-13cross1) ... Selecting previously unselected package g++-x86-64-linux-gnu. Preparing to unpack .../074-g++-x86-64-linux-gnu_4%3a15.2.0-5_arm64.deb ... Unpacking g++-x86-64-linux-gnu (4:15.2.0-5) ... Selecting previously unselected package crossbuild-essential-amd64. Preparing to unpack .../075-crossbuild-essential-amd64_12.12_all.deb ... Unpacking crossbuild-essential-amd64 (12.12) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../076-libdebhelper-perl_13.30_all.deb ... Unpacking libdebhelper-perl (13.30) ... Selecting previously unselected package libtool. Preparing to unpack .../077-libtool_2.5.4-9_all.deb ... Unpacking libtool (2.5.4-9) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../078-dh-autoreconf_21+nmu1_all.deb ... Unpacking dh-autoreconf (21+nmu1) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../079-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../080-libfile-stripnondeterminism-perl_1.15.0-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.15.0-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../081-dh-strip-nondeterminism_1.15.0-1_all.deb ... Unpacking dh-strip-nondeterminism (1.15.0-1) ... Selecting previously unselected package libelf1t64:arm64. Preparing to unpack .../082-libelf1t64_0.194-1_arm64.deb ... Unpacking libelf1t64:arm64 (0.194-1) ... Selecting previously unselected package dwz. Preparing to unpack .../083-dwz_0.16-2+b1_arm64.deb ... Unpacking dwz (0.16-2+b1) ... Selecting previously unselected package gettext. Preparing to unpack .../084-gettext_0.23.2-1_arm64.deb ... Unpacking gettext (0.23.2-1) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../085-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../086-po-debconf_1.0.22_all.deb ... Unpacking po-debconf (1.0.22) ... Selecting previously unselected package debhelper. Preparing to unpack .../087-debhelper_13.30_all.deb ... Unpacking debhelper (13.30) ... Selecting previously unselected package gcc-15-base:amd64. Preparing to unpack .../088-gcc-15-base_15.2.0-13_amd64.deb ... Unpacking gcc-15-base:amd64 (15.2.0-13) ... Selecting previously unselected package libgcc-s1:amd64. Preparing to unpack .../089-libgcc-s1_15.2.0-13_amd64.deb ... Unpacking libgcc-s1:amd64 (15.2.0-13) ... Selecting previously unselected package libc-gconv-modules-extra:amd64. Preparing to unpack .../090-libc-gconv-modules-extra_2.42-13_amd64.deb ... Unpacking libc-gconv-modules-extra:amd64 (2.42-13) ... Selecting previously unselected package libc6:amd64. Preparing to unpack .../091-libc6_2.42-13_amd64.deb ... Unpacking libc6:amd64 (2.42-13) ... Selecting previously unselected package libasan8:amd64. Preparing to unpack .../092-libasan8_15.2.0-13_amd64.deb ... Unpacking libasan8:amd64 (15.2.0-13) ... Selecting previously unselected package libatomic1:amd64. Preparing to unpack .../093-libatomic1_15.2.0-13_amd64.deb ... Unpacking libatomic1:amd64 (15.2.0-13) ... Selecting previously unselected package libbz2-1.0:amd64. Preparing to unpack .../094-libbz2-1.0_1.0.8-6+b1_amd64.deb ... Unpacking libbz2-1.0:amd64 (1.0.8-6+b1) ... Selecting previously unselected package libc6-dev:amd64. Preparing to unpack .../095-libc6-dev_2.42-13_amd64.deb ... Unpacking libc6-dev:amd64 (2.42-13) ... Selecting previously unselected package libbz2-dev:amd64. Preparing to unpack .../096-libbz2-dev_1.0.8-6+b1_amd64.deb ... Unpacking libbz2-dev:amd64 (1.0.8-6+b1) ... Selecting previously unselected package libgomp1:amd64. Preparing to unpack .../097-libgomp1_15.2.0-13_amd64.deb ... Unpacking libgomp1:amd64 (15.2.0-13) ... Selecting previously unselected package libitm1:amd64. Preparing to unpack .../098-libitm1_15.2.0-13_amd64.deb ... Unpacking libitm1:amd64 (15.2.0-13) ... Selecting previously unselected package liblsan0:amd64. Preparing to unpack .../099-liblsan0_15.2.0-13_amd64.deb ... Unpacking liblsan0:amd64 (15.2.0-13) ... Selecting previously unselected package libtsan2:amd64. Preparing to unpack .../100-libtsan2_15.2.0-13_amd64.deb ... Unpacking libtsan2:amd64 (15.2.0-13) ... Selecting previously unselected package libstdc++6:amd64. Preparing to unpack .../101-libstdc++6_15.2.0-13_amd64.deb ... Unpacking libstdc++6:amd64 (15.2.0-13) ... Selecting previously unselected package libubsan1:amd64. Preparing to unpack .../102-libubsan1_15.2.0-13_amd64.deb ... Unpacking libubsan1:amd64 (15.2.0-13) ... Selecting previously unselected package libhwasan0:amd64. Preparing to unpack .../103-libhwasan0_15.2.0-13_amd64.deb ... Unpacking libhwasan0:amd64 (15.2.0-13) ... Selecting previously unselected package libquadmath0:amd64. Preparing to unpack .../104-libquadmath0_15.2.0-13_amd64.deb ... Unpacking libquadmath0:amd64 (15.2.0-13) ... Selecting previously unselected package libgcc-15-dev:amd64. Preparing to unpack .../105-libgcc-15-dev_15.2.0-13_amd64.deb ... Unpacking libgcc-15-dev:amd64 (15.2.0-13) ... Selecting previously unselected package libudev1:amd64. Preparing to unpack .../106-libudev1_259.1-1_amd64.deb ... Unpacking libudev1:amd64 (259.1-1) ... Selecting previously unselected package libhwloc15:amd64. Preparing to unpack .../107-libhwloc15_2.13.0-2_amd64.deb ... Unpacking libhwloc15:amd64 (2.13.0-2) ... Selecting previously unselected package libseqan2-dev. Preparing to unpack .../108-libseqan2-dev_2.5.2-1_all.deb ... Unpacking libseqan2-dev (2.5.2-1) ... Selecting previously unselected package libstdc++-15-dev:amd64. Preparing to unpack .../109-libstdc++-15-dev_15.2.0-13_amd64.deb ... Unpacking libstdc++-15-dev:amd64 (15.2.0-13) ... Selecting previously unselected package libtbbbind-2-5:amd64. Preparing to unpack .../110-libtbbbind-2-5_2022.3.0-2_amd64.deb ... Unpacking libtbbbind-2-5:amd64 (2022.3.0-2) ... Selecting previously unselected package libtbbmalloc2:amd64. Preparing to unpack .../111-libtbbmalloc2_2022.3.0-2_amd64.deb ... Unpacking libtbbmalloc2:amd64 (2022.3.0-2) ... Selecting previously unselected package libtbb12:amd64. Preparing to unpack .../112-libtbb12_2022.3.0-2_amd64.deb ... Unpacking libtbb12:amd64 (2022.3.0-2) ... Selecting previously unselected package libtbb-dev:amd64. Preparing to unpack .../113-libtbb-dev_2022.3.0-2_amd64.deb ... Unpacking libtbb-dev:amd64 (2022.3.0-2) ... Selecting previously unselected package zlib1g:amd64. Preparing to unpack .../114-zlib1g_1%3a1.3.dfsg+really1.3.1-3_amd64.deb ... Unpacking zlib1g:amd64 (1:1.3.dfsg+really1.3.1-3) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../115-zlib1g-dev_1%3a1.3.dfsg+really1.3.1-3_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-3) ... Selecting previously unselected package sbuild-build-depends-main-dummy:amd64. Preparing to unpack .../116-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-main-dummy:amd64 (0.invalid.0) ... Setting up libc-gconv-modules-extra:amd64 (2.42-13) ... Setting up libexpat1:arm64 (2.7.4-1) ... Setting up libpipeline1:arm64 (1.5.8-2) ... Setting up libkeyutils1:arm64 (1.6.3-6+b1) ... Setting up linux-libc-dev-amd64-cross (6.18.12-1) ... Setting up bsdextrautils (2.41.3-3) ... Setting up libmagic-mgc (1:5.46-5+b1) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up libxml2-16:arm64 (2.15.1+dfsg-2+b1) ... Setting up libdebhelper-perl (13.30) ... Setting up libbrotli1:arm64 (1.2.0-3) ... Setting up libuv1t64:arm64 (1.51.0-2+b1) ... Setting up libmagic1t64:arm64 (1:5.46-5+b1) ... Setting up libnghttp2-14:arm64 (1.68.0-1) ... Setting up gettext-base (0.23.2-1) ... Setting up m4 (1.4.21-1) ... Setting up gcc-15-x86-64-linux-gnu-base:arm64 (15.2.0-13cross1) ... Setting up libcom-err2:arm64 (1.47.2-3+b8) ... Setting up file (1:5.46-5+b1) ... Setting up cpp-15-x86-64-linux-gnu (15.2.0-13cross1) ... Setting up libelf1t64:arm64 (0.194-1) ... Setting up libkrb5support0:arm64 (1.22.1-2) ... Setting up libseqan2-dev (2.5.2-1) ... Setting up libsasl2-modules-db:arm64 (2.1.28+dfsg1-10) ... Setting up autotools-dev (20240727.1) ... Setting up libjsoncpp26:arm64 (1.9.6-5) ... Setting up libproc2-0:arm64 (2:4.0.4-9+b1) ... Setting up libunistring5:arm64 (1.3-2+b1) ... Setting up autopoint (0.23.2-1) ... Setting up libc6-amd64-cross (2.42-12cross1) ... Setting up libncursesw6:arm64 (6.6+20251231-1) ... Setting up libk5crypto3:arm64 (1.22.1-2) ... Setting up libsasl2-2:arm64 (2.1.28+dfsg1-10) ... Setting up autoconf (2.72-3.1) ... Setting up libnghttp3-9:arm64 (1.12.0-1) ... Setting up libffi8:arm64 (3.5.2-3+b1) ... Setting up dwz (0.16-2+b1) ... Setting up sensible-utils (0.0.26) ... Setting up libuchardet0:arm64 (0.0.8-2+b1) ... Setting up procps (2:4.0.4-9+b1) ... Setting up libtasn1-6:arm64 (4.21.0-2) ... Setting up libngtcp2-16:arm64 (1.16.0-1) ... Setting up cmake-data (4.2.3-2) ... Setting up librhash1:arm64 (1.4.6-1.1) ... Setting up libkrb5-3:arm64 (1.22.1-2) ... Setting up libssh2-1t64:arm64 (1.11.1-1+b1) ... Setting up gcc-15-cross-base (15.2.0-13cross1) ... Setting up libgcc-s1-amd64-cross (15.2.0-13cross1) ... Setting up gcc-15-base:amd64 (15.2.0-13) ... Setting up libarchive13t64:arm64 (3.8.5-1) ... Setting up libldap2:arm64 (2.6.10+dfsg-1+b1) ... Setting up binutils-x86-64-linux-gnu (2.46-2) ... Setting up libstdc++6-amd64-cross (15.2.0-13cross1) ... Setting up cpp-x86-64-linux-gnu (4:15.2.0-5) ... Setting up automake (1:1.18.1-3) ... update-alternatives: using /usr/bin/automake-1.18 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.15.0-1) ... Setting up gettext (0.23.2-1) ... Setting up libtool (2.5.4-9) ... Setting up libasan8-amd64-cross (15.2.0-13cross1) ... Setting up liblsan0-amd64-cross (15.2.0-13cross1) ... Setting up libc6-dev-amd64-cross (2.42-12cross1) ... Setting up libtsan2-amd64-cross (15.2.0-13cross1) ... Setting up libidn2-0:arm64 (2.3.8-4+b1) ... Setting up libgomp1-amd64-cross (15.2.0-13cross1) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (21+nmu1) ... Setting up libitm1-amd64-cross (15.2.0-13cross1) ... Setting up libatomic1-amd64-cross (15.2.0-13cross1) ... Setting up libhwasan0-amd64-cross (15.2.0-13cross1) ... Setting up libp11-kit0:arm64 (0.25.10-1+b1) ... Setting up libquadmath0-amd64-cross (15.2.0-13cross1) ... Setting up libgssapi-krb5-2:arm64 (1.22.1-2) ... Setting up libubsan1-amd64-cross (15.2.0-13cross1) ... Setting up libngtcp2-crypto-ossl0:arm64 (1.16.0-1) ... Setting up dh-strip-nondeterminism (1.15.0-1) ... Setting up groff-base (1.23.0-10+b1) ... Setting up libgnutls30t64:arm64 (3.8.12-2) ... Setting up po-debconf (1.0.22) ... Setting up libpsl5t64:arm64 (0.21.2-1.1+b2) ... Setting up man-db (2.13.1-1+b1) ... Not building database; man-db/auto-update is not 'true'. Setting up libgcc-15-dev-amd64-cross (15.2.0-13cross1) ... Setting up librtmp1:arm64 (2.4+20151223.gitfa8646d.1-3+b1) ... Setting up libstdc++-15-dev-amd64-cross (15.2.0-13cross1) ... Setting up libcurl4t64:arm64 (8.18.0-2) ... Setting up debhelper (13.30) ... Setting up gcc-15-x86-64-linux-gnu (15.2.0-13cross1) ... Setting up cmake (4.2.3-2) ... Setting up g++-15-x86-64-linux-gnu (15.2.0-13cross1) ... Setting up gcc-x86-64-linux-gnu (4:15.2.0-5) ... Setting up g++-x86-64-linux-gnu (4:15.2.0-5) ... Setting up crossbuild-essential-amd64 (12.12) ... Setting up libgcc-s1:amd64 (15.2.0-13) ... Setting up libc6:amd64 (2.42-13) ... Setting up libudev1:amd64 (259.1-1) ... Setting up libhwasan0:amd64 (15.2.0-13) ... Setting up libasan8:amd64 (15.2.0-13) ... Setting up libc6-dev:amd64 (2.42-13) ... Setting up libtsan2:amd64 (15.2.0-13) ... Setting up libbz2-1.0:amd64 (1.0.8-6+b1) ... Setting up libstdc++6:amd64 (15.2.0-13) ... Setting up liblsan0:amd64 (15.2.0-13) ... Setting up libitm1:amd64 (15.2.0-13) ... Setting up libbz2-dev:amd64 (1.0.8-6+b1) ... Setting up libtbbmalloc2:amd64 (2022.3.0-2) ... Setting up zlib1g:amd64 (1:1.3.dfsg+really1.3.1-3) ... Setting up libgomp1:amd64 (15.2.0-13) ... Setting up libquadmath0:amd64 (15.2.0-13) ... Setting up libhwloc15:amd64 (2.13.0-2) ... Setting up libatomic1:amd64 (15.2.0-13) ... Setting up libubsan1:amd64 (15.2.0-13) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg+really1.3.1-3) ... Setting up libgcc-15-dev:amd64 (15.2.0-13) ... Setting up libtbbbind-2-5:amd64 (2022.3.0-2) ... Setting up libstdc++-15-dev:amd64 (15.2.0-13) ... Setting up libtbb12:amd64 (2022.3.0-2) ... Setting up libtbb-dev:amd64 (2022.3.0-2) ... Setting up sbuild-build-depends-main-dummy:amd64 (0.invalid.0) ... Processing triggers for base-files (14) ... Processing triggers for libc-bin (2.42-13) ... +------------------------------------------------------------------------------+ | Check architectures Fri, 20 Feb 2026 20:02:05 +0000 | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in any) +------------------------------------------------------------------------------+ | Build environment Fri, 20 Feb 2026 20:02:06 +0000 | +------------------------------------------------------------------------------+ Kernel: Linux 6.12.57+deb13-arm64 #1 SMP Debian 6.12.57-1 (2025-11-05) arm64 (aarch64) Toolchain package versions: binutils_2.46-2 dpkg-dev_1.23.5 g++-15_15.2.0-13 gcc-15_15.2.0-13 libc6-dev_2.42-13 libstdc++-15-dev_15.2.0-13 libstdc++-15-dev-amd64-cross_15.2.0-13cross1 libstdc++6_15.2.0-13 libstdc++6-amd64-cross_15.2.0-13cross1 linux-libc-dev_6.18.12-1 Package versions: apt_3.1.16 apt-utils_3.1.16 autoconf_2.72-3.1 automake_1:1.18.1-3 autopoint_0.23.2-1 autotools-dev_20240727.1 base-files_14 base-passwd_3.6.8+b1 bash_5.3-2 binutils_2.46-2 binutils-aarch64-linux-gnu_2.46-2 binutils-common_2.46-2 binutils-x86-64-linux-gnu_2.46-2 bsdextrautils_2.41.3-3 build-essential_12.12 bzip2_1.0.8-6+b1 cmake_4.2.3-2 cmake-data_4.2.3-2 coreutils_9.7-3+b1 cpp_4:15.2.0-5 cpp-15_15.2.0-13 cpp-15-aarch64-linux-gnu_15.2.0-13 cpp-15-x86-64-linux-gnu_15.2.0-13cross1 cpp-aarch64-linux-gnu_4:15.2.0-5 cpp-x86-64-linux-gnu_4:15.2.0-5 crossbuild-essential-amd64_12.12 dash_0.5.12-12+b1 debconf_1.5.92 debhelper_13.30 debian-archive-keyring_2025.1 debianutils_5.23.2+b1 dh-autoreconf_21+nmu1 dh-strip-nondeterminism_1.15.0-1 diffutils_1:3.12-1+b1 dpkg_1.23.5 dpkg-dev_1.23.5 dwz_0.16-2+b1 file_1:5.46-5+b1 findutils_4.10.0-3+b1 g++_4:15.2.0-5 g++-15_15.2.0-13 g++-15-aarch64-linux-gnu_15.2.0-13 g++-15-x86-64-linux-gnu_15.2.0-13cross1 g++-aarch64-linux-gnu_4:15.2.0-5 g++-x86-64-linux-gnu_4:15.2.0-5 gcc_4:15.2.0-5 gcc-15_15.2.0-13 gcc-15-aarch64-linux-gnu_15.2.0-13 gcc-15-base_15.2.0-13 gcc-15-cross-base_15.2.0-13cross1 gcc-15-x86-64-linux-gnu_15.2.0-13cross1 gcc-15-x86-64-linux-gnu-base_15.2.0-13cross1 gcc-aarch64-linux-gnu_4:15.2.0-5 gcc-x86-64-linux-gnu_4:15.2.0-5 gettext_0.23.2-1 gettext-base_0.23.2-1 grep_3.12-1+b1 groff-base_1.23.0-10+b1 gzip_1.13-1+b1 hostname_3.25+b1 init-system-helpers_1.69 intltool-debian_0.35.0+20060710.6 libacl1_2.3.2-3 libapt-pkg7.0_3.1.16 libarchive-zip-perl_1.68-1 libarchive13t64_3.8.5-1 libasan8_15.2.0-13 libasan8-amd64-cross_15.2.0-13cross1 libatomic1_15.2.0-13 libatomic1-amd64-cross_15.2.0-13cross1 libattr1_1:2.5.2-4 libaudit-common_1:4.1.2-1 libaudit1_1:4.1.2-1+b1 libbinutils_2.46-2 libblkid1_2.41.3-3 libbrotli1_1.2.0-3 libbz2-1.0_1.0.8-6+b1 libbz2-dev_1.0.8-6+b1 libc-bin_2.42-13 libc-dev-bin_2.42-13 libc-gconv-modules-extra_2.42-13 libc6_2.42-13 libc6-amd64-cross_2.42-12cross1 libc6-dev_2.42-13 libc6-dev-amd64-cross_2.42-12cross1 libcap-ng0_0.9.1-1 libcap2_1:2.75-10+b5 libcc1-0_15.2.0-13 libcom-err2_1.47.2-3+b8 libcrypt1_1:4.5.1-1 libctf-nobfd0_2.46-2 libctf0_2.46-2 libcurl4t64_8.18.0-2 libdb5.3t64_5.3.28+dfsg2-11 libdebconfclient0_0.282+b2 libdebhelper-perl_13.30 libdpkg-perl_1.23.5 libelf1t64_0.194-1 libexpat1_2.7.4-1 libffi8_3.5.2-3+b1 libfile-stripnondeterminism-perl_1.15.0-1 libgcc-15-dev_15.2.0-13 libgcc-15-dev-amd64-cross_15.2.0-13cross1 libgcc-s1_15.2.0-13 libgcc-s1-amd64-cross_15.2.0-13cross1 libgdbm-compat4t64_1.26-1+b1 libgdbm6t64_1.26-1+b1 libgmp10_2:6.3.0+dfsg-5+b1 libgnutls30t64_3.8.12-2 libgomp1_15.2.0-13 libgomp1-amd64-cross_15.2.0-13cross1 libgprofng0_2.46-2 libgssapi-krb5-2_1.22.1-2 libhogweed6t64_3.10.2-1 libhwasan0_15.2.0-13 libhwasan0-amd64-cross_15.2.0-13cross1 libhwloc15_2.13.0-2 libidn2-0_2.3.8-4+b1 libisl23_0.27-1+b1 libitm1_15.2.0-13 libitm1-amd64-cross_15.2.0-13cross1 libjansson4_2.14-2+b4 libjsoncpp26_1.9.6-5 libk5crypto3_1.22.1-2 libkeyutils1_1.6.3-6+b1 libkrb5-3_1.22.1-2 libkrb5support0_1.22.1-2 libldap2_2.6.10+dfsg-1+b1 liblsan0_15.2.0-13 liblsan0-amd64-cross_15.2.0-13cross1 liblz4-1_1.10.0-6 liblzma5_5.8.2-2 libmagic-mgc_1:5.46-5+b1 libmagic1t64_1:5.46-5+b1 libmd0_1.1.0-2+b2 libmount1_2.41.3-3 libmpc3_1.3.1-2+b1 libmpfr6_4.2.2-2+b1 libncursesw6_6.6+20251231-1 libnettle8t64_3.10.2-1 libnghttp2-14_1.68.0-1 libnghttp3-9_1.12.0-1 libngtcp2-16_1.16.0-1 libngtcp2-crypto-ossl0_1.16.0-1 libp11-kit0_0.25.10-1+b1 libpam-modules_1.7.0-5+b1 libpam-modules-bin_1.7.0-5+b1 libpam-runtime_1.7.0-5 libpam0g_1.7.0-5+b1 libpcre2-8-0_10.46-1+b1 libperl5.40_5.40.1-7 libpipeline1_1.5.8-2 libproc2-0_2:4.0.4-9+b1 libpsl5t64_0.21.2-1.1+b2 libquadmath0_15.2.0-13 libquadmath0-amd64-cross_15.2.0-13cross1 librhash1_1.4.6-1.1 librtmp1_2.4+20151223.gitfa8646d.1-3+b1 libsasl2-2_2.1.28+dfsg1-10 libsasl2-modules-db_2.1.28+dfsg1-10 libseccomp2_2.6.0-2+b1 libselinux1_3.9-4+b1 libseqan2-dev_2.5.2-1 libsframe3_2.46-2 libsmartcols1_2.41.3-3 libssh2-1t64_1.11.1-1+b1 libssl3t64_3.5.5-1 libstdc++-15-dev_15.2.0-13 libstdc++-15-dev-amd64-cross_15.2.0-13cross1 libstdc++6_15.2.0-13 libstdc++6-amd64-cross_15.2.0-13cross1 libsystemd0_259.1-1 libtasn1-6_4.21.0-2 libtbb-dev_2022.3.0-2 libtbb12_2022.3.0-2 libtbbbind-2-5_2022.3.0-2 libtbbmalloc2_2022.3.0-2 libtinfo6_6.6+20251231-1 libtool_2.5.4-9 libtsan2_15.2.0-13 libtsan2-amd64-cross_15.2.0-13cross1 libubsan1_15.2.0-13 libubsan1-amd64-cross_15.2.0-13cross1 libuchardet0_0.0.8-2+b1 libudev1_259.1-1 libunistring5_1.3-2+b1 libuuid1_2.41.3-3 libuv1t64_1.51.0-2+b1 libxml2-16_2.15.1+dfsg-2+b1 libxxhash0_0.8.3-2+b1 libzstd1_1.5.7+dfsg-3+b1 linux-libc-dev_6.18.12-1 linux-libc-dev-amd64-cross_6.18.12-1 login_1:4.16.0-2+really2.41.3-3 login.defs_1:4.19.2-1 m4_1.4.21-1 make_4.4.1-3+b1 man-db_2.13.1-1+b1 mawk_1.3.4.20260129-1 ncurses-base_6.6+20251231-1 ncurses-bin_6.6+20251231-1 openssl-provider-legacy_3.5.5-1 patch_2.8-2+b1 perl_5.40.1-7 perl-base_5.40.1-7 perl-modules-5.40_5.40.1-7 po-debconf_1.0.22 procps_2:4.0.4-9+b1 rpcsvc-proto_1.4.3-1+b2 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-2+b2 sensible-utils_0.0.26 sqv_1.3.0-5 sysvinit-utils_3.15-6+b1 tar_1.35+dfsg-4 util-linux_2.41.3-3 xz-utils_5.8.2-2 zlib1g_1:1.3.dfsg+really1.3.1-3 zlib1g-dev_1:1.3.dfsg+really1.3.1-3 +------------------------------------------------------------------------------+ | Build Fri, 20 Feb 2026 20:02:06 +0000 | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: flexbar Binary: flexbar Architecture: any Version: 1:3.5.0-7 Maintainer: Debian Med Packaging Team Uploaders: Andreas Tille , Tony Travis , Homepage: https://github.com/seqan/flexbar Standards-Version: 4.7.2 Vcs-Browser: https://salsa.debian.org/med-team/flexbar Vcs-Git: https://salsa.debian.org/med-team/flexbar.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), libtbb-dev, cmake, libseqan2-dev, zlib1g-dev, libbz2-dev Package-List: flexbar deb science optional arch=any Checksums-Sha1: 0c43550b73a08effdd3a7965e916dc9c6b64f8b2 44021 flexbar_3.5.0.orig.tar.gz d78f24c160f3a3b5995f228e12fdd570303e6be3 11324 flexbar_3.5.0-7.debian.tar.xz Checksums-Sha256: 656168934b6cb367ee6d4adad0c40506bc107c888d129fe191c6f3f3446a4ac9 44021 flexbar_3.5.0.orig.tar.gz f9f4e5fcdaa49e742e8921bb23654efe0a678011c2295014afa8f174c2a1299f 11324 flexbar_3.5.0-7.debian.tar.xz Files: 0e07bf4afebfd731c4718b401383224a 44021 flexbar_3.5.0.orig.tar.gz 2567bc6e033a4f4afb7c18864a0353aa 11324 flexbar_3.5.0-7.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCgAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAmjyLuMRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtFocRAAkayc3bYx2yhR2DyM/SlKZpSYxuGdYwg3 WFLAUJvRDDjiLY88eMI8s8XLL4Ot4VgfGUXxGJ7samvAIgqss+/YEXOcS8nvrS9r 6icB1//ff6qSWnjsn8Mz9V44RUw5yoArVZ0DWJvzY2xHL7hQCgolOuUZ/zfkxxlC 6cDN/g873+qEuVyiwNpYl94tj4jQf1fUPhAeUVzc72m+5roVV167lwA2vU74puGH n/UwZlpwW106V3pMvD3rYN6IJkPVdC8T8o++fXv+MMey7WNlktvBYPqe9OItgoVF xWqin7VI3FuqJvZV9W/dvTnANBLwBuAixAw8pJdvZwUyjyn2Bfu0KtFEnYlP0MsZ xMqxVZUIPQZZWYeKFUh5eb+/5DBAVJyUWCsfqM0R0IYXzveEevjGoidh/J23m8r/ dbHbSO1x4GO7n4IT2RhJ+TJor1/Q4E4VDApNP5K3/H8AOBdwWXONCrg7b3gLxkmx ywIUvO5CpAJNMBh7T1XgKfsnW7gqoY8ZzV/yE2w4blMVBxxsLzhdLLOrUYy68CMq c+wv9cuoZpRQYuGGJ+XurF0u4dUOFgWGQXY2pmDIEy25ZWi2ncYTtUyn1Fh9nyIt gwMezIUy/YFltl2W7GmBncd1Yn7n4WpnnEDJcuiQesKwo95pIWNGSGScKdz8QMmg EXAaxGR5Kds= =2RnR -----END PGP SIGNATURE----- dpkg-source: warning: cannot verify inline signature for ./flexbar_3.5.0-7.dsc: missing OpenPGP keyrings dpkg-source: info: verifying ./flexbar_3.5.0-7.dsc dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-keyring.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-tag2upload.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-nonupload.pgp dpkg-source: info: skipping absent keyring /usr/share/keyrings/debian-maintainers.pgp dpkg-source: info: extracting flexbar in /build/reproducible-path/flexbar-3.5.0 dpkg-source: info: unpacking flexbar_3.5.0.orig.tar.gz dpkg-source: info: unpacking flexbar_3.5.0-7.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying no_march_native.patch dpkg-source: info: applying 195a1ab2c2715b07df5acff58dc2a0396d9cd52d.patch dpkg-source: info: applying 1c872fa10d474f090633fc95d409aa60607a3f96.patch dpkg-source: info: applying 19722f2743c96235ff57948eda82f963cf734131.patch dpkg-source: info: applying a9b0eb87a391aeaf760f8116dca777749c8b4f96.patch Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf CONFIG_SITE=/etc/dpkg-cross/cross-config.amd64 DEB_BUILD_OPTIONS=nocheck HOME=/sbuild-nonexistent LANG=en_GB.UTF-8 LC_ALL=C.UTF-8 LOGNAME=sbuild PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SHELL=/bin/sh USER=sbuild dpkg-buildpackage ----------------- Command: dpkg-buildpackage --sanitize-env -aamd64 -Pcross,nocheck -us -uc -B --jobs-try=1 dpkg-buildpackage: info: source package flexbar dpkg-buildpackage: info: source version 1:3.5.0-7 dpkg-buildpackage: info: source distribution unstable dpkg-buildpackage: info: source changed by Andreas Tille dpkg-architecture: warning: specified GNU system type x86_64-linux-gnu does not match CC system type aarch64-linux-gnu, try setting a correct CC environment variable dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean debian/rules override_dh_auto_clean make[1]: Entering directory '/build/reproducible-path/flexbar-3.5.0' dh_auto_clean rm -f test/result_*fast[aq] test/result_*.log make[1]: Leaving directory '/build/reproducible-path/flexbar-3.5.0' dh_clean debian/rules binary-arch dh binary-arch dh_update_autotools_config -a dh_autoreconf -a debian/rules override_dh_auto_configure-arch make[1]: Entering directory '/build/reproducible-path/flexbar-3.5.0' dh_auto_configure -- -DCMAKE_POLICY_VERSION_MINIMUM=3.5 cd obj-x86_64-linux-gnu && DEB_PYTHON_INSTALL_LAYOUT=deb PKG_CONFIG=/usr/bin/x86_64-linux-gnu-pkg-config cmake -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_USE_PACKAGE_REGISTRY=OFF -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON -DFETCHCONTENT_FULLY_DISCONNECTED=ON -DCMAKE_INSTALL_RUNSTATEDIR=/run -DCMAKE_SKIP_INSTALL_ALL_DEPENDENCY=ON "-GUnix Makefiles" -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_SYSTEM_NAME=Linux -DCMAKE_SYSTEM_PROCESSOR=x86_64 -DCMAKE_C_COMPILER=x86_64-linux-gnu-gcc -DCMAKE_CXX_COMPILER=x86_64-linux-gnu-g\+\+ -DPKG_CONFIG_EXECUTABLE=/usr/bin/x86_64-linux-gnu-pkg-config -DPKGCONFIG_EXECUTABLE=/usr/bin/x86_64-linux-gnu-pkg-config -DQMAKE_EXECUTABLE=/usr/bin/x86_64-linux-gnu-qmake -DCMAKE_INSTALL_LIBDIR=lib/x86_64-linux-gnu -DBUILD_TESTING:BOOL=OFF -DCMAKE_POLICY_VERSION_MINIMUM=3.5 .. CMake Deprecation Warning at CMakeLists.txt:1 (cmake_minimum_required): Compatibility with CMake < 3.10 will be removed from a future version of CMake. Update the VERSION argument value. Or, use the ... syntax to tell CMake that the project requires at least but has been updated to work with policies introduced by or earlier. -- The C compiler identification is GNU 15.2.0 -- The CXX compiler identification is GNU 15.2.0 -- Detecting C compiler ABI info -- Detecting C compiler ABI info - done -- Check for working C compiler: /usr/bin/x86_64-linux-gnu-gcc - skipped -- Detecting C compile features -- Detecting C compile features - done -- Detecting CXX compiler ABI info -- Detecting CXX compiler ABI info - done -- Check for working CXX compiler: /usr/bin/x86_64-linux-gnu-g++ - skipped -- Detecting CXX compile features -- Detecting CXX compile features - done CMake Deprecation Warning at src/CMakeLists.txt:1 (cmake_minimum_required): Compatibility with CMake < 3.10 will be removed from a future version of CMake. Update the VERSION argument value. Or, use the ... syntax to tell CMake that the project requires at least but has been updated to work with policies introduced by or earlier. -- Performing Test COMPILER_SUPPORTS_CXX14 -- Performing Test COMPILER_SUPPORTS_CXX14 - Success -- Flexbar 64 bit architecture -- Found ZLIB: /usr/lib/x86_64-linux-gnu/libz.so (found version "1.3.1") -- Found BZip2: /usr/lib/x86_64-linux-gnu/libbz2.so (found version "1.0.8") -- Looking for BZ2_bzCompressInit -- Looking for BZ2_bzCompressInit - found -- Configuring done (2.4s) -- Generating done (0.0s) CMake Warning: Manually-specified variables were not used by the project: BUILD_TESTING CMAKE_EXPORT_NO_PACKAGE_REGISTRY CMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY CMAKE_INSTALL_LIBDIR CMAKE_INSTALL_LOCALSTATEDIR CMAKE_INSTALL_RUNSTATEDIR CMAKE_INSTALL_SYSCONFDIR FETCHCONTENT_FULLY_DISCONNECTED PKGCONFIG_EXECUTABLE PKG_CONFIG_EXECUTABLE QMAKE_EXECUTABLE -- Build files have been written to: /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu make[1]: Leaving directory '/build/reproducible-path/flexbar-3.5.0' dh_auto_build -a cd obj-x86_64-linux-gnu && make -j1 INSTALL="install --strip-program=true" VERBOSE=1 make[1]: Entering directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' /usr/bin/cmake -S/build/reproducible-path/flexbar-3.5.0 -B/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu --check-build-system CMakeFiles/Makefile.cmake 0 /usr/bin/cmake -E cmake_progress_start /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu/CMakeFiles /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu//CMakeFiles/progress.marks make -f CMakeFiles/Makefile2 all make[2]: Entering directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' make -f src/CMakeFiles/flexbar.dir/build.make src/CMakeFiles/flexbar.dir/depend make[3]: Entering directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' cd /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu && /usr/bin/cmake -E cmake_depends "Unix Makefiles" /build/reproducible-path/flexbar-3.5.0 /build/reproducible-path/flexbar-3.5.0/src /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu/src /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu/src/CMakeFiles/flexbar.dir/DependInfo.cmake "--color=" flexbar make[3]: Leaving directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' make -f src/CMakeFiles/flexbar.dir/build.make src/CMakeFiles/flexbar.dir/build make[3]: Entering directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' [ 50%] Building CXX object src/CMakeFiles/flexbar.dir/Flexbar.cpp.o cd /build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu/src && /usr/bin/x86_64-linux-gnu-g++ -DSEQAN_HAS_BZIP2=1 -DSEQAN_HAS_ZLIB=1 -I/build/reproducible-path/flexbar-3.5.0/include -g -O2 -ffile-prefix-map=/build/reproducible-path/flexbar-3.5.0=. -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -Wdate-time -D_FORTIFY_SOURCE=2 -std=c++14 -MD -MT src/CMakeFiles/flexbar.dir/Flexbar.cpp.o -MF CMakeFiles/flexbar.dir/Flexbar.cpp.o.d -o CMakeFiles/flexbar.dir/Flexbar.cpp.o -c /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp In file included from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:26, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp:24: /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:96:17: error: ‘seqan’ does not name a type 96 | typedef seqan::Dna5String FSeqStr; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:97:17: error: ‘seqan’ does not name a type 97 | typedef seqan::CharString FString; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:99:17: error: ‘seqan’ does not name a type 99 | typedef seqan::StringSet TSeqStrs; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:100:17: error: ‘seqan’ does not name a type 100 | typedef seqan::StringSet TStrings; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:101:17: error: ‘seqan’ does not name a type 101 | typedef seqan::StringSet TBools; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:103:25: error: ‘FSeqStr’ was not declared in this scope 103 | typedef SeqRead TSeqRead; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:103:34: error: ‘FString’ was not declared in this scope 103 | typedef SeqRead TSeqRead; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:103:41: error: template argument 1 is invalid 103 | typedef SeqRead TSeqRead; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:103:41: error: template argument 2 is invalid /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:104:28: error: ‘FSeqStr’ was not declared in this scope 104 | typedef PairedRead TPairedRead; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:104:37: error: ‘FString’ was not declared in this scope 104 | typedef PairedRead TPairedRead; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:104:44: error: template argument 1 is invalid 104 | typedef PairedRead TPairedRead; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:104:44: error: template argument 2 is invalid /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:106:17: error: ‘seqan’ does not name a type 106 | typedef seqan::Align TAlign; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:107:17: error: ‘seqan’ does not name a type 107 | typedef seqan::StringSet TAlignSet; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:108:17: error: ‘seqan’ does not name a type 108 | typedef seqan::String TAlignScores; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:111:17: error: ‘TAlignSet’ does not name a type 111 | TAlignSet aset; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:112:17: error: ‘TAlignScores’ does not name a type 112 | TAlignScores ascores; | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:139:17: error: ‘FString’ does not name a type 139 | FString id; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:140:17: error: ‘FSeqStr’ does not name a type 140 | FSeqStr seq; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:154:17: error: ‘FString’ does not name a type 154 | FString id, info; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarTypes.h:155:17: error: ‘FSeqStr’ does not name a type 155 | FSeqStr seq1, seq2, seqc; | ^~~~~~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/Options.h:12, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:27: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:55:33: error: ‘Tag’ does not name a type 55 | using DatFastaAdaptor = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:58:35: error: ‘FormattedFile’ does not name a type 58 | using DatFastaSeqFileIn = FormattedFile; | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:62:35: error: ‘Tag’ does not name a type 62 | using DatFastaSeqFormat = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:65:38: error: ‘TagList’ does not name a type 65 | using DatFastaSeqInFormats = TagList; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:16: error: ‘FileFormat’ is not a class template 69 | struct FileFormat >{ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 69 | struct FileFormat >{ | ^~~~~~~~~~~~~ | seqan2::FormattedFile In file included from /usr/include/seqan/stream.h:111, from /usr/include/seqan/score.h:43, from /usr/include/seqan/graph_align.h:45, from /usr/include/seqan/align.h:59, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:21: /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 69 | struct FileFormat >{ | ^~~~~ | seqan2::Fastq In file included from /usr/include/seqan/seq_io.h:52, from /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:11: /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’? 69 | struct FileFormat >{ | ^~~~~ | seqan2::Input In file included from /usr/include/seqan/file.h:71, from /usr/include/seqan/stream.h:62: /usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here 165 | typedef Tag Input; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:55: error: ‘DatFastaAdaptor’ was not declared in this scope; did you mean ‘DatFastaAdaptor_’? 69 | struct FileFormat >{ | ^~~~~~~~~~~~~~~ | DatFastaAdaptor_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:69:72: error: expected unqualified-id before ‘>’ token 69 | struct FileFormat >{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:16: error: ‘MagicHeader’ is not a class template 75 | struct MagicHeader : public MagicHeader{}; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:28: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’? 75 | struct MagicHeader : public MagicHeader{}; | ^~~~~~~~~~~~~~~~~ | DatFastaSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:71: error: ‘Fasta’ was not declared in this scope; did you mean ‘seqan2::Fasta’? [-Wtemplate-body] 75 | struct MagicHeader : public MagicHeader{}; | ^~~~~ | seqan2::Fasta /usr/include/seqan/seq_io/fasta_fastq.h:52:24: note: ‘seqan2::Fasta’ declared here 52 | typedef Tag Fasta; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:79: error: wrong number of template arguments (2, should be 1) [-Wtemplate-body] 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:48: note: provided for ‘template struct seqan::MagicHeader’ 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:16: error: ‘FileExtensions’ is not a class template 79 | struct FileExtensions{ | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:31: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’? 79 | struct FileExtensions{ | ^~~~~~~~~~~~~~~~~ | DatFastaSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:37: error: ‘DatFastaSeqFormat’ was not declared in this scope; did you mean ‘DatFastaSeqFormat_’? 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~ | DatFastaSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:57: error: wrong number of template arguments (2, should be 1) 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:51: note: provided for ‘template struct seqan::FileExtensions’ 79 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:90:54: error: ‘FormattedFile’ has not been declared 90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastaSeqFormat){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:90:67: error: expected ‘,’ or ‘...’ before ‘<’ token 90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastaSeqFormat){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: In function ‘void seqan::readRecord(TIdString&, TSeqString&, int)’: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:91:33: error: ‘file’ was not declared in this scope [-Wtemplate-body] 91 | readRecord(id, seq, file.iter, Fasta()); // Delegate to Fasta parser | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:91:44: error: there are no arguments to ‘Fasta’ that depend on a template parameter, so a declaration of ‘Fasta’ must be available [-Wtemplate-body] 91 | readRecord(id, seq, file.iter, Fasta()); // Delegate to Fasta parser | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:91:44: note: (if you use ‘-fpermissive’, G++ will accept your code, but allowing the use of an undeclared name is deprecated) /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:98:33: error: ‘Tag’ does not name a type 98 | using DatFastqAdaptor = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:101:35: error: ‘FormattedFile’ does not name a type 101 | using DatFastqSeqFileIn = FormattedFile; | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:105:35: error: ‘Tag’ does not name a type 105 | using DatFastqSeqFormat = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:108:38: error: ‘TagList’ does not name a type 108 | using DatFastqSeqInFormats = TagList; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:16: error: ‘FileFormat’ is not a class template 112 | struct FileFormat >{ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 112 | struct FileFormat >{ | ^~~~~~~~~~~~~ | seqan2::FormattedFile /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 112 | struct FileFormat >{ | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’? 112 | struct FileFormat >{ | ^~~~~ | seqan2::Input /usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here 165 | typedef Tag Input; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:55: error: ‘DatFastqAdaptor’ was not declared in this scope; did you mean ‘DatFastqAdaptor_’? 112 | struct FileFormat >{ | ^~~~~~~~~~~~~~~ | DatFastqAdaptor_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:112:72: error: expected unqualified-id before ‘>’ token 112 | struct FileFormat >{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:118:28: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’? 118 | struct MagicHeader : public MagicHeader{}; | ^~~~~~~~~~~~~~~~~ | DatFastqSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:118:48: error: wrong number of template arguments (2, should be 1) 118 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:48: note: provided for ‘template struct seqan::MagicHeader’ 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:118:71: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 118 | struct MagicHeader : public MagicHeader{}; | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:118:79: error: wrong number of template arguments (2, should be 1) 118 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:48: note: provided for ‘template struct seqan::MagicHeader’ 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:122:31: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’? 122 | struct FileExtensions{ | ^~~~~~~~~~~~~~~~~ | DatFastqSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:122:51: error: wrong number of template arguments (2, should be 1) 122 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:51: note: provided for ‘template struct seqan::FileExtensions’ 79 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:127:37: error: ‘DatFastqSeqFormat’ was not declared in this scope; did you mean ‘DatFastqSeqFormat_’? 127 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~ | DatFastqSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:127:57: error: wrong number of template arguments (2, should be 1) 127 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:51: note: provided for ‘template struct seqan::FileExtensions’ 79 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:127:22: error: redefinition of ‘template const char* seqan::VALUE [1]’ 127 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘template const char* seqan::VALUE [1]’ previously declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:133:72: error: ‘FormattedFile’ has not been declared 133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, DatFastqSeqFormat){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:133:85: error: expected ‘,’ or ‘...’ before ‘<’ token 133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, DatFastqSeqFormat){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: In function ‘void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:134:39: error: ‘file’ was not declared in this scope [-Wtemplate-body] 134 | readRecord(id, seq, qual, file.iter, Fastq()); // Delegate to Fastq parser | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:134:50: error: there are no arguments to ‘Fastq’ that depend on a template parameter, so a declaration of ‘Fastq’ must be available [-Wtemplate-body] 134 | readRecord(id, seq, qual, file.iter, Fastq()); // Delegate to Fastq parser | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:139:54: error: ‘FormattedFile’ has not been declared 139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastqSeqFormat){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:139:67: error: expected ‘,’ or ‘...’ before ‘<’ token 139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastqSeqFormat){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:139:9: error: redefinition of ‘template void seqan::readRecord(TIdString&, TSeqString&, int)’ 139 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastqSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:90:9: note: ‘template void seqan::readRecord(TIdString&, TSeqString&, int)’ previously declared here 90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastaSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:147:37: error: ‘Tag’ does not name a type 147 | using FlexbarReadsAdaptor = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:150:39: error: ‘FormattedFile’ does not name a type 150 | using FlexbarReadsSeqFileIn = FormattedFile; | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:154:39: error: ‘Tag’ does not name a type 154 | using FlexbarReadsSeqFormat = Tag; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:157:42: error: ‘TagList’ does not name a type 157 | using FlexbarReadsSeqInFormats = TagList; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:16: error: ‘FileFormat’ is not a class template 161 | struct FileFormat >{ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 161 | struct FileFormat >{ | ^~~~~~~~~~~~~ | seqan2::FormattedFile /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 161 | struct FileFormat >{ | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:48: error: ‘Input’ was not declared in this scope; did you mean ‘seqan2::Input’? 161 | struct FileFormat >{ | ^~~~~ | seqan2::Input /usr/include/seqan/file/file_interface.h:165:21: note: ‘seqan2::Input’ declared here 165 | typedef Tag Input; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:55: error: ‘FlexbarReadsAdaptor’ was not declared in this scope; did you mean ‘FlexbarReadsAdaptor_’? 161 | struct FileFormat >{ | ^~~~~~~~~~~~~~~~~~~ | FlexbarReadsAdaptor_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:161:76: error: expected unqualified-id before ‘>’ token 161 | struct FileFormat >{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:167:28: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’? 167 | struct MagicHeader : public MagicHeader{}; | ^~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:167:52: error: wrong number of template arguments (2, should be 1) 167 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:48: note: provided for ‘template struct seqan::MagicHeader’ 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:167:75: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 167 | struct MagicHeader : public MagicHeader{}; | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:167:83: error: wrong number of template arguments (2, should be 1) 167 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:75:48: note: provided for ‘template struct seqan::MagicHeader’ 75 | struct MagicHeader : public MagicHeader{}; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:171:31: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’? 171 | struct FileExtensions{ | ^~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:171:55: error: wrong number of template arguments (2, should be 1) 171 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:51: note: provided for ‘template struct seqan::FileExtensions’ 79 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:176:37: error: ‘FlexbarReadsSeqFormat’ was not declared in this scope; did you mean ‘FlexbarReadsSeqFormat_’? 176 | char const * FileExtensions::VALUE[1] = { ".txt" }; | ^~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:176:61: error: wrong number of template arguments (2, should be 1) 176 | char const * FileExtensions::VALUE[1] = { ".txt" }; | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:79:51: note: provided for ‘template struct seqan::FileExtensions’ 79 | struct FileExtensions{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:176:22: error: redefinition of ‘template const char* seqan::VALUE [1]’ 176 | char const * FileExtensions::VALUE[1] = { ".txt" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘template const char* seqan::VALUE [1]’ previously declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:182:72: error: ‘FormattedFile’ has not been declared 182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, FlexbarReadsSeqFormat){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:182:85: error: expected ‘,’ or ‘...’ before ‘<’ token 182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, FlexbarReadsSeqFormat){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:182:9: error: redefinition of ‘template void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’ 182 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, FlexbarReadsSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:133:9: note: ‘template void seqan::readRecord(TIdString&, TSeqString&, TIdString&, int)’ previously declared here 133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, DatFastqSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:188:54: error: ‘FormattedFile’ has not been declared 188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, FlexbarReadsSeqFormat){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:188:67: error: expected ‘,’ or ‘...’ before ‘<’ token 188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, FlexbarReadsSeqFormat){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:188:9: error: redefinition of ‘template void seqan::readRecord(TIdString&, TSeqString&, int)’ 188 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, FlexbarReadsSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:90:9: note: ‘template void seqan::readRecord(TIdString&, TSeqString&, int)’ previously declared here 90 | readRecord(TIdString & id, TSeqString & seq, FormattedFile & file, DatFastaSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:195:40: error: ‘FormattedFile’ does not name a type 195 | using FlexbarReadsSeqFileOut = FormattedFile; | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:197:43: error: ‘TagList’ does not name a type 197 | using FlexbarReadsSeqOutFormats = TagList; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:16: error: ‘FileFormat’ is not a class template 200 | struct FileFormat >{ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:27: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 200 | struct FileFormat >{ | ^~~~~~~~~~~~~ | seqan2::FormattedFile /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:41: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 200 | struct FileFormat >{ | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:48: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’? 200 | struct FileFormat >{ | ^~~~~~ | seqan2::Output /usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here 168 | typedef Tag Output; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:56: error: ‘DatFastqAdaptor’ was not declared in this scope; did you mean ‘DatFastqAdaptor_’? 200 | struct FileFormat >{ | ^~~~~~~~~~~~~~~ | DatFastqAdaptor_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:200:73: error: expected unqualified-id before ‘>’ token 200 | struct FileFormat >{ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:9: error: variable or field ‘writeRecord’ declared void 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:21: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~~~~~~~~~~ | seqan2::FormattedFile /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:35: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:42: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’? 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~~~ | seqan2::Output /usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here 168 | typedef Tag Output; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:55: error: expected primary-expression before ‘>’ token 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:59: error: ‘file’ was not declared in this scope 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:75: error: expected primary-expression before ‘&’ token 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:77: error: ‘id’ was not declared in this scope 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:92: error: expected primary-expression before ‘&’ token 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:94: error: ‘seq’ was not declared in this scope 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:109: error: expected primary-expression before ‘&’ token 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:208:111: error: ‘qual’ was not declared in this scope 208 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq, TIdString & qual){ | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:9: error: variable or field ‘writeRecord’ declared void 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:21: error: ‘FormattedFile’ was not declared in this scope; did you mean ‘seqan2::FormattedFile’? 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~~~~~~~~~~~ | seqan2::FormattedFile /usr/include/seqan/stream/formatted_file.h:213:8: note: ‘seqan2::FormattedFile’ declared here 213 | struct FormattedFile | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:35: error: ‘Fastq’ was not declared in this scope; did you mean ‘seqan2::Fastq’? 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~~~ | seqan2::Fastq /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:42: error: ‘Output’ was not declared in this scope; did you mean ‘seqan2::Output’? 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~~~~ | seqan2::Output /usr/include/seqan/file/file_interface.h:168:22: note: ‘seqan2::Output’ declared here 168 | typedef Tag Output; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:55: error: expected primary-expression before ‘>’ token 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:59: error: ‘file’ was not declared in this scope 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:75: error: expected primary-expression before ‘&’ token 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:77: error: ‘id’ was not declared in this scope 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:92: error: expected primary-expression before ‘&’ token 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:214:94: error: ‘seq’ was not declared in this scope 214 | writeRecord(FormattedFile & file, TIdString & id, TSeqString & seq){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: In function ‘void checkFileCompression(std::string)’: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:225:22: error: ‘CharString’ has not been declared in ‘seqan’ 225 | using seqan::CharString; | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:226:22: error: ‘suffix’ has not been declared in ‘seqan’ 226 | using seqan::suffix; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:227:22: error: ‘length’ has not been declared in ‘seqan’ 227 | using seqan::length; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:231:12: error: ‘length’ was not declared in this scope; did you mean ‘seqan2::length’? 231 | if(length(path) > 3){ | ^~~~~~ | seqan2::length In file included from /usr/include/seqan/bam_io.h:62, from /usr/include/seqan/seq_io/bam_sam.h:39, from /usr/include/seqan/seq_io.h:55: /usr/include/seqan/bam_io/bam_tags_dict.h:364:1: note: ‘seqan2::length’ declared here 364 | length(BamTagsDict const & tags) | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:232:17: error: ‘CharString’ was not declared in this scope; did you mean ‘seqan2::CharString’? 232 | CharString ending = suffix(path, length(path) - 3); | ^~~~~~~~~~ | seqan2::CharString In file included from /usr/include/seqan/sequence.h:112, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:20: /usr/include/seqan/sequence/sequence_shortcuts.h:55:36: note: ‘seqan2::CharString’ declared here 55 | typedef String > CharString; | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:234:20: error: ‘ending’ was not declared in this scope 234 | if(ending == ".gz"){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:245:34: error: ‘suffix’ was not declared in this scope; did you mean ‘seqan2::suffix’? 245 | ending = suffix(path, length(path) - 4); | ^~~~~~ | seqan2::suffix In file included from /usr/include/seqan/sequence.h:136: /usr/include/seqan/sequence/string_set_concat_direct.h:605:1: note: ‘seqan2::suffix’ declared here 605 | suffix(StringSet > > const & me, TPosition pos) | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h: In function ‘void checkInputType(std::string, flexbar::FileFormat&, bool)’: /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:288:24: error: ‘FlexbarReadsSeqFileIn’ is not a member of ‘seqan’; did you mean ‘FlexbarReadsSeqFormat_’? 288 | seqan::FlexbarReadsSeqFileIn seqFileIn; | ^~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:290:27: error: ‘seqFileIn’ was not declared in this scope 290 | if(! open(seqFileIn, path.c_str())){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:296:36: error: ‘seqFileIn’ was not declared in this scope 296 | if(! atEnd(seqFileIn)){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:296:30: error: ‘atEnd’ was not declared in this scope; did you mean ‘seqan2::atEnd’? 296 | if(! atEnd(seqFileIn)){ | ^~~~~ | seqan2::atEnd In file included from /usr/include/seqan/store.h:61, from /usr/include/seqan/seq_io/fai_index.h:41, from /usr/include/seqan/seq_io.h:73: /usr/include/seqan/store/store_annotation.h:623:1: note: ‘seqan2::atEnd’ declared here 623 | atEnd(Iter > & it) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:298:33: error: ‘FString’ was not declared in this scope 298 | FString id, seq, qual; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:300:44: error: ‘id’ was not declared in this scope 300 | readRecord(id, seq, qual, seqFileIn); | ^~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:300:48: error: ‘seq’ was not declared in this scope 300 | readRecord(id, seq, qual, seqFileIn); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:300:53: error: ‘qual’ was not declared in this scope 300 | readRecord(id, seq, qual, seqFileIn); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:300:33: error: ‘readRecord’ was not declared in this scope 300 | readRecord(id, seq, qual, seqFileIn); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:300:33: note: suggested alternatives: /usr/include/seqan/seq_io/fai_index.h:438:1: note: ‘seqan2::readRecord’ 438 | readRecord(FaiIndexEntry_ & entry, TFwdIterator & reader, CharString & buffer) | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:133:9: note: ‘seqan::readRecord’ 133 | readRecord(TIdString & id, TSeqString & seq, TIdString & qual, FormattedFile & file, DatFastqSeqFormat){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:311:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type 311 | catch(seqan::Exception const &e){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:311:39: error: expected ‘)’ before ‘const’ 311 | catch(seqan::Exception const &e){ | ~ ^~~~~~ | ) /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:311:40: error: expected ‘{’ before ‘const’ 311 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:311:48: error: expected initializer before ‘)’ token 311 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:317:23: error: ‘seqFileIn’ was not declared in this scope 317 | close(seqFileIn); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/Options.h:125:49: error: ‘CharString’ in namespace ‘seqan’ does not name a type 125 | const std::string getFlexbarBanner(const seqan::CharString version){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: In function ‘const std::string getFlexbarBanner(int)’: /build/reproducible-path/flexbar-3.5.0/src/Options.h:137:9: error: ‘append’ was not declared in this scope; did you mean ‘seqan2::append’? 137 | append(banner, version); | ^~~~~~ | seqan2::append In file included from /usr/include/seqan/arg_parse.h:65, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:24: /usr/include/seqan/arg_parse/tool_doc.h:735:13: note: ‘seqan2::append’ declared here 735 | inline void append(ToolDoc & a, ToolDoc const & b) | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/Options.h:160:6: error: variable or field ‘defineOptions’ declared void 160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){ | ^~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:160:27: error: ‘ArgumentParser’ is not a member of ‘seqan’; did you mean ‘seqan2::ArgumentParser’? 160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){ | ^~~~~~~~~~~~~~ In file included from /usr/include/seqan/arg_parse.h:71: /usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here 152 | class ArgumentParser | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:160:43: error: ‘parser’ was not declared in this scope; did you mean ‘pause’? 160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){ | ^~~~~~ | pause /build/reproducible-path/flexbar-3.5.0/src/Options.h:160:51: error: expected primary-expression before ‘const’ 160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:160:78: error: expected primary-expression before ‘const’ 160 | void defineOptions(seqan::ArgumentParser &parser, const std::string version, const std::string date){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:6: error: variable or field ‘parseCmdLine’ declared void 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:26: error: ‘ArgumentParser’ is not a member of ‘seqan’; did you mean ‘seqan2::ArgumentParser’? 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~~~~~~~~~~~~ /usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here 152 | class ArgumentParser | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:42: error: ‘parser’ was not declared in this scope; did you mean ‘pause’? 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~~~~ | pause /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:62: error: expected primary-expression before ‘version’ 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:71: error: expected primary-expression before ‘int’ 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:429:81: error: expected primary-expression before ‘char’ 429 | void parseCmdLine(seqan::ArgumentParser &parser, std::string version, int argc, char const ** argv){ | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:500:37: error: ‘seqan::ArgumentParser’ has not been declared 500 | void initOptions(Options &o, seqan::ArgumentParser &parser){ | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: In function ‘void initOptions(Options&, int&)’: /build/reproducible-path/flexbar-3.5.0/src/Options.h:505:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 505 | bool stdOutReads = isSet(parser, "stdout-reads"); | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:516:17: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’? 516 | getOptionValue(s, parser, "target"); | ^~~~~~~~~~~~~~ | seqan2::getOptionValue /usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here 704 | inline bool getOptionValue(TValue & val, | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:531:9: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’? 531 | getOptionValue(o.readsFile, parser, "reads"); | ^~~~~~~~~~~~~~ | seqan2::getOptionValue /usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here 704 | inline bool getOptionValue(TValue & val, | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/Options.h:536:37: error: ‘seqan::ArgumentParser’ has not been declared 536 | void loadOptions(Options &o, seqan::ArgumentParser &parser){ | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h: In function ‘void loadOptions(Options&, int&)’: /build/reproducible-path/flexbar-3.5.0/src/Options.h:543:34: error: ‘getVersion’ was not declared in this scope; did you mean ‘seqan2::getVersion’? 543 | *out << getFlexbarBanner(getVersion(parser)) << endl; | ^~~~~~~~~~ | seqan2::getVersion In file included from /usr/include/seqan/arg_parse.h:73: /usr/include/seqan/arg_parse/arg_parse_doc.h:326:27: note: ‘seqan2::getVersion’ declared here 326 | inline CharString const & getVersion(ArgumentParser const & me) | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:551:9: error: ‘getOptionValue’ was not declared in this scope; did you mean ‘seqan2::getOptionValue’? 551 | getOptionValue(o.nThreads, parser, "threads"); | ^~~~~~~~~~~~~~ | seqan2::getOptionValue /usr/include/seqan/arg_parse/argument_parser.h:704:13: note: ‘seqan2::getOptionValue’ declared here 704 | inline bool getOptionValue(TValue & val, | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:567:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 567 | if(isSet(parser, "bundles")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:599:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 599 | if(isSet(parser, "interleaved")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:606:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 606 | if(isSet(parser, "reads2")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:627:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 627 | if(isSet(parser, "iupac")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:635:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 635 | if(isSet(parser, "barcodes")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:673:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 673 | if(isSet(parser, "adapters")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:684:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 684 | if(isSet(parser, "adapters2") && o.adapRm == NORMAL && o.isPaired){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:690:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 690 | if(isSet(parser, "adapter-preset")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:725:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 725 | if(isSet(parser, "pre-trim-left")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:730:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 730 | if(isSet(parser, "pre-trim-right")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:735:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 735 | if(isSet(parser, "post-trim-length")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:756:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 756 | if(isSet(parser, "qtrim") && o.format == FASTQ){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:817:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 817 | if(isSet(parser, "htrim-left") || isSet(parser, "htrim-right")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:858:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 858 | if(isSet(parser, "align-log")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:866:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 866 | if(isSet(parser, "zip-output")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:879:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 879 | if(isSet(parser, "single-reads")) o.writeSingleReads = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:881:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 881 | if(isSet(parser, "single-reads-paired")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:888:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 888 | if(isSet(parser, "output-reads") && (isSet(parser, "output-reads2") || o.runType == SINGLE)){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:892:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 892 | if(isSet(parser, "output-reads2") && isSet(parser, "output-reads") && o.runType == PAIRED){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:907:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 907 | if(isSet(parser, "fasta-output")) o.switch2Fasta = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:908:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 908 | if(isSet(parser, "length-dist")) o.writeLengthDist = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:909:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 909 | if(isSet(parser, "number-tags")) o.useNumberTag = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:910:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 910 | if(isSet(parser, "removal-tags")) o.useRemovalTag = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:911:12: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 911 | if(isSet(parser, "umi-tags")) o.umiTags = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:935:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 935 | if(isSet(parser, "barcode-tail-length")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:940:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 940 | if(isSet(parser, "barcode-min-overlap")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:958:20: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 958 | if(isSet(parser, "barcode-unassigned")) o.writeUnassigned = true; | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:980:26: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 980 | if(o.isPaired && isSet(parser, "adapter-pair-overlap")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1019:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1019 | if(isSet(parser, "adapter-tail-length")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1024:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1024 | if(isSet(parser, "adapter-revcomp")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1055:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1055 | if(isSet(parser, "adapter-relaxed")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1060:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1060 | if(isSet(parser, "adapter-add-barcode") && o.isPaired && o.a_end == RIGHT && o.rcMode != RCON && | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1067:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1067 | if(isSet(parser, "adapter-trimmed-out")){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/Options.h:1076:28: error: ‘isSet’ was not declared in this scope; did you mean ‘seqan2::isSet’? 1076 | if(isSet(parser, "adapter-read-set") && o.isPaired && o.adapRm != NORMAL2){ | ^~~~~ | seqan2::isSet /usr/include/seqan/arg_parse/argument_parser.h:599:13: note: ‘seqan2::isSet’ declared here 599 | inline bool isSet(ArgumentParser const & me, std::string const & name) | ^~~~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:29: /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h: In member function ‘void LoadFasta::loadSequences(std::string)’: /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:36:24: error: ‘DatFastaSeqFileIn’ is not a member of ‘seqan’; did you mean ‘DatFastaSeqFormat_’? [-Wtemplate-body] 36 | seqan::DatFastaSeqFileIn seqFileIn; | ^~~~~~~~~~~~~~~~~ | DatFastaSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:38:27: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 38 | if(! open(seqFileIn, filePath.c_str())){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:44:25: error: ‘TSeqStrs’ was not declared in this scope; did you mean ‘TSeqStr’? [-Wtemplate-body] 44 | TSeqStrs seqs; | ^~~~~~~~ | TSeqStr /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:45:25: error: ‘TStrings’ was not declared in this scope; did you mean ‘TString’? [-Wtemplate-body] 45 | TStrings ids; | ^~~~~~~~ | TString /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:47:37: error: ‘ids’ was not declared in this scope [-Wtemplate-body] 47 | readRecords(ids, seqs, seqFileIn); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:47:42: error: ‘seqs’ was not declared in this scope [-Wtemplate-body] 47 | readRecords(ids, seqs, seqFileIn); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:47:48: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 47 | readRecords(ids, seqs, seqFileIn); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:47:25: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-Wtemplate-body] 47 | readRecords(ids, seqs, seqFileIn); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:51:53: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 51 | for(unsigned int i = 0; i < length(ids); ++i){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:67:45: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 67 | bar.id = ids[i]; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:68:45: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 68 | bar.seq = seqs[i]; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:77:48: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 77 | seqan::reverseComplement(seq); | ^~~~~~~~~~~~~~~~~ In file included from /usr/include/seqan/modifier.h:77, from /usr/include/seqan/align.h:57: /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:80:47: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 80 | barRC.id = id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:81:47: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 81 | barRC.seq = seq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:87:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type [-Wtemplate-body] 87 | catch(seqan::Exception const &e){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:87:40: error: expected ‘)’ before ‘const’ [-Wtemplate-body] 87 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:87:22: note: to match this ‘(’ 87 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:87:40: error: expected ‘{’ before ‘const’ [-Wtemplate-body] 87 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:87:48: error: expected initializer before ‘)’ token [-Wtemplate-body] 87 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:93:23: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 93 | close(seqFileIn); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h: In member function ‘void LoadFasta::printBars(std::string) const’: /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:121:53: error: ‘const tbb::detail::d1::concurrent_vector::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 121 | TString seqTag = bars.at(i).id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadFasta.h:128:68: error: ‘const tbb::detail::d1::concurrent_vector::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘seq’ [-Wtemplate-body] 128 | *out << seqTag << whiteSpace << bars.at(i).seq << "\n"; | ^~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:30: /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h: In constructor ‘LoadAdapters::LoadAdapters(const Options&)’: /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:35:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 35 | a.id = "TruSeq"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:36:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 36 | a.seq1 = "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:37:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’ [-Wtemplate-body] 37 | a.seq2 = "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:38:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 38 | a.info = "TruSeq LT and TruSeq HT-based kits"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:41:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 41 | a.id = "TrueSeq-Methyl"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:42:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 42 | a.seq1 = "AGATCGGAAGAGCACACGTCTGAAC"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:43:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’ [-Wtemplate-body] 43 | a.seq2 = "AGATCGGAAGAGCGTCGTGTAGGGA"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:44:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 44 | a.info = "ScriptSeq and TruSeq DNA Methylation"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:47:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 47 | a.id = "TrueSeq-smallRNA"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:48:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 48 | a.seq1 = "TGGAATTCTCGGGTGCCAAGG"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:49:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 49 | a.info = "TruSeq Small RNA"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:52:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 52 | a.id = "TrueSeq-Ribo"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:53:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 53 | a.seq1 = "AGATCGGAAGAGCACACGTCT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:54:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 54 | a.info = "TruSeq Ribo Profile"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:57:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 57 | a.id = "Nextera-TruSight"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:58:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 58 | a.seq1 = "CTGTCTCTTATACACATCT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:59:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 59 | a.info = "AmpliSeq, Nextera, Nextera DNA Flex, Nextera DNA, Nextera XT, Nextera Enrichment, Nextera Rapid Capture Enrichment, TruSight Enrichment, TruSight Rapid Capture Enrichment, TruSight HLA"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:62:27: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 62 | a.id = "Nextera-Matepair"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:63:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 63 | a.seq1 = "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:64:27: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’ [-Wtemplate-body] 64 | a.seq2 = "GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:65:27: error: ‘struct flexbar::Adapters’ has no member named ‘seqc’ [-Wtemplate-body] 65 | a.seqc = "CTGTCTCTTATACACATCT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:66:27: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 66 | a.info = "Nextera Mate Pair"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:72:28: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 72 | IonTorrent.id = "IonTorrent"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:73:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 73 | IonTorrent.seq1 = "ATCACCGACTGCCCATAGAGAGGCTGAGAC"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:74:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 74 | IonTorrent.seq1 = "CCATCTCATCCCTGCGTGTCTCCGACTCAG"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:75:28: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’ [-Wtemplate-body] 75 | IonTorrent.seq2 = "CCTCTCTATGGGCAGTCGGTGAT"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:76:28: error: ‘struct flexbar::Adapters’ has no member named ‘info’ [-Wtemplate-body] 76 | IonTorrent.info = "IonTorrent"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h: In member function ‘void LoadAdapters::loadSequences(bool)’: /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:88:32: error: ‘struct flexbar::Adapters’ has no member named ‘id’ [-Wtemplate-body] 88 | TString id = a.id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:91:41: error: ‘struct flexbar::Adapters’ has no member named ‘seq1’ [-Wtemplate-body] 91 | if(! secondSet) seq = a.seq1; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:92:41: error: ‘struct flexbar::Adapters’ has no member named ‘seq2’ [-Wtemplate-body] 92 | else seq = a.seq2; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:96:33: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 96 | adapter.id = id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:97:33: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 97 | adapter.seq = seq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:106:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 106 | seqan::reverseComplement(seqRC); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:109:35: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 109 | adapterRC.id = idRC; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:110:35: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 110 | adapterRC.seq = seqRC; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:117:42: error: ‘struct flexbar::Adapters’ has no member named ‘seqc’ [-Wtemplate-body] 117 | TSeqStr seqc = a.seqc; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:122:33: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 122 | adapter.id = idc; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:123:33: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 123 | adapter.seq = seqc; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:127:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 127 | seqan::reverseComplement(seqc); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:130:35: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 130 | adapterRC.id = idc; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:131:35: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 131 | adapterRC.seq = seqc; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h: In member function ‘void LoadAdapters::printAdapters(std::string) const’: /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:156:57: error: ‘const tbb::detail::d1::concurrent_vector::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 156 | TString seqTag = adapters.at(i).id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/LoadAdapters.h:163:72: error: ‘const tbb::detail::d1::concurrent_vector::value_type’ {aka ‘const struct flexbar::TBar’} has no member named ‘seq’ [-Wtemplate-body] 163 | *out << seqTag << whiteSpace << adapters.at(i).seq << "\n"; | ^~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:31: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:15:16: error: ‘FlexbarReadsSeqFileIn’ in namespace ‘seqan’ does not name a type; did you mean ‘FlexbarReadsSeqFormat_’? [-Wtemplate-body] 15 | seqan::FlexbarReadsSeqFileIn seqFileIn; | ^~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:64:42: error: ‘seqan::StringSet’ has not been declared [-Wtemplate-body] 64 | unsigned int loadSeqReads(seqan::StringSet &uncalled, flexbar::TStrings &ids, flexbar::TSeqStrs &seqs, flexbar::TStrings &quals, const unsigned int nReads){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:64:51: error: expected ‘,’ or ‘...’ before ‘<’ token [-Wtemplate-body] 64 | unsigned int loadSeqReads(seqan::StringSet &uncalled, flexbar::TStrings &ids, flexbar::TSeqStrs &seqs, flexbar::TStrings &quals, const unsigned int nReads){ | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h: In constructor ‘SeqInput::SeqInput(const Options&, std::string, bool, bool)’: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:45:35: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 45 | if(! open(seqFileIn, cin)){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:51:35: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 51 | if(! open(seqFileIn, filePath.c_str())){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h: In destructor ‘virtual SeqInput::~SeqInput()’: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:59:23: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 59 | close(seqFileIn); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h: In member function ‘unsigned int SeqInput::loadSeqReads(int)’: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:69:30: error: ‘prefix’ has not been declared in ‘seqan’ [-Wtemplate-body] 69 | using seqan::prefix; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:70:30: error: ‘suffix’ has not been declared in ‘seqan’ [-Wtemplate-body] 70 | using seqan::suffix; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:71:30: error: ‘length’ has not been declared in ‘seqan’ [-Wtemplate-body] 71 | using seqan::length; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:74:36: error: ‘seqFileIn’ was not declared in this scope [-Wtemplate-body] 74 | if(! atEnd(seqFileIn)){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:74:30: error: there are no arguments to ‘atEnd’ that depend on a template parameter, so a declaration of ‘atEnd’ must be available [-Wtemplate-body] 74 | if(! atEnd(seqFileIn)){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:76:41: error: ‘ids’ was not declared in this scope [-Wtemplate-body] 76 | reserve(ids, nReads); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:76:51: error: ‘nReads’ was not declared in this scope; did you mean ‘read’? [-Wtemplate-body] 76 | reserve(ids, nReads); | ^~~~~~ | read /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:76:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 76 | reserve(ids, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:77:41: error: ‘seqs’ was not declared in this scope [-Wtemplate-body] 77 | reserve(seqs, nReads); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:77:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 77 | reserve(seqs, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:78:41: error: ‘uncalled’ was not declared in this scope [-Wtemplate-body] 78 | reserve(uncalled, nReads); | ^~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:78:33: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 78 | reserve(uncalled, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:83:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-Wtemplate-body] 83 | readRecords(ids, seqs, seqFileIn, nReads); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:86:57: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 86 | reserve(quals, nReads); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:86:49: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 86 | reserve(quals, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:87:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-Wtemplate-body] 87 | readRecords(ids, seqs, quals, seqFileIn, nReads); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:91:48: error: ‘StringSet’ is not a member of ‘seqan’; did you mean ‘seqan2::StringSet’? [-Wtemplate-body] 91 | seqan::StringSet seqsIupac; | ^~~~~~~~~ In file included from /usr/include/seqan/sequence.h:133: /usr/include/seqan/sequence/sequence_concatenator.h:50:7: note: ‘seqan2::StringSet’ declared here 50 | class StringSet; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:91:65: error: ‘IupacString’ is not a member of ‘seqan’; did you mean ‘seqan2::IupacString’? [-Wtemplate-body] 91 | seqan::StringSet seqsIupac; | ^~~~~~~~~~~ /usr/include/seqan/sequence/sequence_shortcuts.h:215:37: note: ‘seqan2::IupacString’ declared here 215 | typedef String > IupacString; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:91:78: error: ‘seqsIupac’ was not declared in this scope [-Wtemplate-body] 91 | seqan::StringSet seqsIupac; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:93:41: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 93 | reserve(seqsIupac, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:96:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-Wtemplate-body] 96 | readRecords(ids, seqsIupac, seqFileIn, nReads); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:99:57: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 99 | reserve(quals, nReads); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:99:49: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 99 | reserve(quals, nReads); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:100:49: error: there are no arguments to ‘readRecords’ that depend on a template parameter, so a declaration of ‘readRecords’ must be available [-Wtemplate-body] 100 | readRecords(ids, seqsIupac, quals, seqFileIn, nReads); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:106:61: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 106 | for(unsigned int i = 0; i < length(ids); ++i){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:136:63: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 136 | erase(quals[i], 0, idx); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:136:57: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 136 | erase(quals[i], 0, idx); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:147:57: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 147 | quals[i] = prefix(quals[i], length(quals[i]) - idx); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:147:85: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 147 | quals[i] = prefix(quals[i], length(quals[i]) - idx); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:151:74: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 151 | if(qualTrim(seq, quals[i], m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:156:46: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 156 | m_nrReads += length(ids); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:158:40: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 158 | return length(ids); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:163:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type [-Wtemplate-body] 163 | catch(seqan::Exception const &e){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:163:40: error: expected ‘)’ before ‘const’ [-Wtemplate-body] 163 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:163:22: note: to match this ‘(’ 163 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:163:40: error: expected ‘{’ before ‘const’ [-Wtemplate-body] 163 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:163:48: error: expected initializer before ‘)’ token [-Wtemplate-body] 163 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h: In member function ‘bool SeqInput::isUncalledSequence(TSeqStr&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:176:26: error: expected nested-name-specifier before ‘Iterator’ [-Wtemplate-body] 176 | typename Iterator::Type it, itEnd; | ^~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:176:26: error: expected ‘(’ before ‘Iterator’ [-Wtemplate-body] /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:178:17: error: ‘it’ was not declared in this scope; did you mean ‘int’? [-Wtemplate-body] 178 | it = begin(seq); | ^~ | int /build/reproducible-path/flexbar-3.5.0/src/SeqInput.h:179:17: error: ‘itEnd’ was not declared in this scope [-Wtemplate-body] 179 | itEnd = end(seq); | ^~~~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:32: /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h: In member function ‘void* PairedInput::loadPairedReadBundle() const’: /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:62:17: error: ‘TSeqStrs’ was not declared in this scope; did you mean ‘TSeqStr’? [-Wtemplate-body] 62 | TSeqStrs seqs, seqs2, seqsBR; | ^~~~~~~~ | TSeqStr /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:63:17: error: ‘TStrings’ was not declared in this scope; did you mean ‘TString’? [-Wtemplate-body] 63 | TStrings ids, ids2, idsBR; | ^~~~~~~~ | TString /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:64:26: error: expected ‘;’ before ‘quals’ [-Wtemplate-body] 64 | TStrings quals, quals2, qualsBR; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:65:17: error: ‘TBools’ was not declared in this scope; did you mean ‘bool’? [-Wtemplate-body] 65 | TBools uncalled, uncalled2, uncalledBR; | ^~~~~~ | bool /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:74:58: error: ‘uncalled’ was not declared in this scope; did you mean ‘m_uncalled’? [-Wtemplate-body] 74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize); | ^~~~~~~~ | m_uncalled /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:74:68: error: ‘ids’ was not declared in this scope [-Wtemplate-body] 74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:74:73: error: ‘seqs’ was not declared in this scope [-Wtemplate-body] 74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:74:79: error: ‘quals’ was not declared in this scope [-Wtemplate-body] 74 | unsigned int nReads = m_f1->loadSeqReads(uncalled, ids, seqs, quals, bundleSize); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:82:67: error: ‘uncalled2’ was not declared in this scope; did you mean ‘m_uncalled’? [-Wtemplate-body] 82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize); | ^~~~~~~~~ | m_uncalled /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:82:78: error: ‘ids2’ was not declared in this scope [-Wtemplate-body] 82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:82:84: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’? [-Wtemplate-body] 82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize); | ^~~~~ | seqan2 /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:82:91: error: ‘quals2’ was not declared in this scope [-Wtemplate-body] 82 | unsigned int nReads2 = m_f2->loadSeqReads(uncalled2, ids2, seqs2, quals2, m_bundleSize); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:91:68: error: ‘uncalledBR’ was not declared in this scope [-Wtemplate-body] 91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:91:80: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:91:87: error: ‘seqsBR’ was not declared in this scope [-Wtemplate-body] 91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:91:95: error: ‘qualsBR’ was not declared in this scope [-Wtemplate-body] 91 | unsigned int nBarReads = m_b->loadSeqReads(uncalledBR, idsBR, seqsBR, qualsBR, m_bundleSize); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:113:53: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 113 | for(unsigned int i = 0; i < length(ids); ++i){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:115:66: error: ‘uncalled2’ was not declared in this scope; did you mean ‘m_uncalled’? [-Wtemplate-body] 115 | if(uncalled[i] || (m_isPaired && uncalled2[i])){ | ^~~~~~~~~ | m_uncalled /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:133:66: error: ‘ids2’ was not declared in this scope [-Wtemplate-body] 133 | if(m_isPaired) ids2[i] = tagCount; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:134:66: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 134 | if(m_useBarRead) idsBR[i] = tagCount; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:141:89: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’? [-Wtemplate-body] 141 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i]); | ^~~~~ | seqan2 /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:141:100: error: ‘ids2’ was not declared in this scope [-Wtemplate-body] 141 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i]); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:142:89: error: ‘seqsBR’ was not declared in this scope [-Wtemplate-body] 142 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:142:100: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 142 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:146:89: error: ‘seqs2’ was not declared in this scope; did you mean ‘seqan2’? [-Wtemplate-body] 146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]); | ^~~~~ | seqan2 /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:146:100: error: ‘ids2’ was not declared in this scope [-Wtemplate-body] 146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:146:110: error: ‘quals2’ was not declared in this scope [-Wtemplate-body] 146 | if(m_isPaired) read2 = new TSeqRead(seqs2[i], ids2[i], quals2[i]); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:147:89: error: ‘seqsBR’ was not declared in this scope [-Wtemplate-body] 147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:147:100: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:147:110: error: ‘qualsBR’ was not declared in this scope [-Wtemplate-body] 147 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:156:65: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 156 | unsigned int nEntries = (unsigned int) (length(ids) / 2); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:183:66: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 183 | if(m_useBarRead) idsBR[i] = tagCount; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:191:89: error: ‘seqsBR’ was not declared in this scope [-Wtemplate-body] 191 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:191:100: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 191 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i]); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:196:89: error: ‘seqsBR’ was not declared in this scope [-Wtemplate-body] 196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:196:100: error: ‘idsBR’ was not declared in this scope [-Wtemplate-body] 196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedInput.h:196:110: error: ‘qualsBR’ was not declared in this scope [-Wtemplate-body] 196 | if(m_useBarRead) barRead = new TSeqRead(seqsBR[i], idsBR[i], qualsBR[i]); | ^~~~~~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:6, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:33: /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:12:16: error: ‘FlexbarReadsSeqFileOut’ in namespace ‘seqan’ does not name a type; did you mean ‘FlexbarReadsSeqFormat_’? [-Wtemplate-body] 12 | seqan::FlexbarReadsSeqFileOut seqFileOut; | ^~~~~~~~~~~~~~~~~~~~~~ | FlexbarReadsSeqFormat_ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h: In constructor ‘SeqOutput::SeqOutput(const std::string&, TString, bool, const Options&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:56:40: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 56 | setFormat(seqFileOut, seqan::Fasta()); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:56:59: error: ‘Fasta’ is not a member of ‘seqan’; did you mean ‘seqan2::Fasta’? [-Wtemplate-body] 56 | setFormat(seqFileOut, seqan::Fasta()); | ^~~~~ /usr/include/seqan/seq_io/fasta_fastq.h:52:24: note: ‘seqan2::Fasta’ declared here 52 | typedef Tag Fasta; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:56:30: error: there are no arguments to ‘setFormat’ that depend on a template parameter, so a declaration of ‘setFormat’ must be available [-Wtemplate-body] 56 | setFormat(seqFileOut, seqan::Fasta()); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:57:40: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 57 | else setFormat(seqFileOut, seqan::Fastq()); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:57:59: error: ‘Fastq’ is not a member of ‘seqan’; did you mean ‘seqan2::Fastq’? [-Wtemplate-body] 57 | else setFormat(seqFileOut, seqan::Fastq()); | ^~~~~ /usr/include/seqan/seq_io/fasta_fastq.h:59:24: note: ‘seqan2::Fastq’ declared here 59 | typedef Tag Fastq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:57:30: error: there are no arguments to ‘setFormat’ that depend on a template parameter, so a declaration of ‘setFormat’ must be available [-Wtemplate-body] 57 | else setFormat(seqFileOut, seqan::Fastq()); | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:59:35: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 59 | if(! open(seqFileOut, cout)){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:65:35: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 65 | if(! open(seqFileOut, m_filePath.c_str())){ | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h: In destructor ‘virtual SeqOutput::~SeqOutput()’: /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:74:41: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 74 | if(! m_useStdout) close(seqFileOut); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h: In member function ‘void SeqOutput::writeSeqRead(flexbar::TSeqRead&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:114:40: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 114 | append(seqRead.id, "_"); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:114:25: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 114 | append(seqRead.id, "_"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:115:40: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 115 | append(seqRead.id, m_tagStr); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:120:45: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:120:65: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:120:77: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:120:33: error: there are no arguments to ‘writeRecord’ that depend on a template parameter, so a declaration of ‘writeRecord’ must be available [-Wtemplate-body] 120 | writeRecord(seqFileOut, seqRead.id, seqRead.seq); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:123:45: error: ‘seqFileOut’ was not declared in this scope [-Wtemplate-body] 123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual); | ^~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:123:65: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:123:77: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:123:90: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:123:33: error: there are no arguments to ‘writeRecord’ that depend on a template parameter, so a declaration of ‘writeRecord’ must be available [-Wtemplate-body] 123 | writeRecord(seqFileOut, seqRead.id, seqRead.seq, seqRead.qual); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:126:30: error: ‘Exception’ in namespace ‘seqan’ does not name a type [-Wtemplate-body] 126 | catch(seqan::Exception const &e){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:126:40: error: expected ‘)’ before ‘const’ [-Wtemplate-body] 126 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:126:22: note: to match this ‘(’ 126 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:126:40: error: expected ‘{’ before ‘const’ [-Wtemplate-body] 126 | catch(seqan::Exception const &e){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqOutput.h:126:48: error: expected initializer before ‘)’ token [-Wtemplate-body] 126 | catch(seqan::Exception const &e){ | ^ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h: In constructor ‘PairedOutput::PairedOutput(Options&)’: /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:88:81: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 88 | TString barcode = m_barcodes->at(idxB1).id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:92:88: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 92 | append(barcode, m_barcodes2->at(idxB2).id); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:210:77: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 210 | TString barcode = m_barcodes->at(i).id; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h: In member function ‘void PairedOutput::writePairedRead(flexbar::TPairedRead*) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:250:43: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 250 | if(pRead->r1 != NULL){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:251:95: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 251 | if(m_runType == SINGLE || m_writeUnassigned || pRead->barID > 0){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:254:76: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 254 | if(qualTrim(pRead->r1, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:257:66: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 257 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:257:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 257 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:258:70: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 258 | else m_outMap[pRead->barID].m_nShort_1++; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:260:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 260 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC)) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:260:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 260 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC)) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:261:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 261 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:261:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 261 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:263:74: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 263 | if(r1ok) m_outMap[pRead->barID].f1->writeRead(pRead->r1); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:263:102: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 263 | if(r1ok) m_outMap[pRead->barID].f1->writeRead(pRead->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:272:43: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 272 | if(pRead->r1 != NULL && pRead->r2 != NULL){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:272:64: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 272 | if(pRead->r1 != NULL && pRead->r2 != NULL){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:274:61: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 274 | int outIdx = pRead->barID; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:277:74: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 277 | if(outIdx == 0 || pRead->barID2 == 0){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:280:72: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 280 | else outIdx += (pRead->barID2 - 1) * m_barcodes->size(); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:286:76: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 286 | if(qualTrim(pRead->r1, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:287:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 287 | if(qualTrim(pRead->r2, m_qtrim, m_qtrimThresh, m_qtrimWinSize)) ++m_nLowPhred; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:290:66: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 290 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:290:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 290 | if(length(pRead->r1->seq) >= m_minLength) r1ok = true; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:291:66: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 291 | if(length(pRead->r2->seq) >= m_minLength) r2ok = true; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:291:52: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 291 | if(length(pRead->r2->seq) >= m_minLength) r2ok = true; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:296:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:296:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:296:144: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 296 | if (m_aTrimmed == ATOFF && (pRead->r1->rmAdapter || pRead->r1->rmAdapterRC || pRead->r1->poRemoval)) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:297:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:297:116: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:297:144: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 297 | else if(m_aTrimmed == ATONLY && ! pRead->r1->rmAdapter && ! pRead->r1->rmAdapterRC && ! pRead->r1->poRemoval) r1ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:299:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:299:116: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:299:144: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 299 | if (m_aTrimmed == ATOFF && (pRead->r2->rmAdapter || pRead->r2->rmAdapterRC || pRead->r2->poRemoval)) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:300:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:300:116: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:300:144: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 300 | else if(m_aTrimmed == ATONLY && ! pRead->r2->rmAdapter && ! pRead->r2->rmAdapterRC && ! pRead->r2->poRemoval) r2ok = false; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:303:95: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 303 | m_outMap[outIdx].f1->writeRead(pRead->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:304:95: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 304 | m_outMap[outIdx].f2->writeRead(pRead->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:310:108: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 310 | m_outMap[outIdx].single1->writeRead(pRead->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:314:72: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 314 | pRead->r2->seq = "N"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:317:72: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 317 | pRead->r2->qual = prefix(pRead->r1->qual, 1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:317:97: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 317 | pRead->r2->qual = prefix(pRead->r1->qual, 1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:317:83: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-Wtemplate-body] 317 | pRead->r2->qual = prefix(pRead->r1->qual, 1); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:319:103: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 319 | m_outMap[outIdx].f1->writeRead(pRead->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:320:103: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 320 | m_outMap[outIdx].f2->writeRead(pRead->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:327:108: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 327 | m_outMap[outIdx].single2->writeRead(pRead->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:331:72: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 331 | pRead->r1->seq = "N"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:334:72: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 334 | pRead->r1->qual = prefix(pRead->r2->qual, 1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:334:97: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 334 | pRead->r1->qual = prefix(pRead->r2->qual, 1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:334:83: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-Wtemplate-body] 334 | pRead->r1->qual = prefix(pRead->r2->qual, 1); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:336:103: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 336 | m_outMap[outIdx].f1->writeRead(pRead->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:337:103: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 337 | m_outMap[outIdx].f2->writeRead(pRead->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h: In member function ‘void PairedOutput::printAdapterRemovalStats(bool)’: /build/reproducible-path/flexbar-3.5.0/src/PairedOutput.h:477:58: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 477 | TString seqTag = adapters->at(i).id; | ^~ In file included from /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:6, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:34: /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h: In member function ‘int SeqAlign::alignSeqRead(flexbar::TSeqRead*, bool, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int&, const flexbar::AlignmentMode&, flexbar::TrimEnd, const TSeqStr&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:62:30: error: ‘prefix’ has not been declared in ‘seqan’ [-Wtemplate-body] 62 | using seqan::prefix; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:63:30: error: ‘suffix’ has not been declared in ‘seqan’ [-Wtemplate-body] 63 | using seqan::suffix; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:66:52: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 66 | int readLength = length(seqRead.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:66:37: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 66 | int readLength = length(seqRead.seq); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:78:59: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 78 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize * m_queries->size()); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:78:40: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 78 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize * m_queries->size()); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:85:67: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’ [-Wtemplate-body] 85 | TSeqStr *qseq = &m_queries->at(i).seq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:86:58: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 86 | TSeqStr *rseq = &seqRead.seq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:91:71: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’ [-Wtemplate-body] 91 | append(tmpq, m_queries->at(i).seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:99:91: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 99 | if(trimEnd == LTAIL) tmp = prefix(seqRead.seq, tailLength); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:99:76: error: there are no arguments to ‘prefix’ that depend on a template parameter, so a declaration of ‘prefix’ must be available [-Wtemplate-body] 99 | if(trimEnd == LTAIL) tmp = prefix(seqRead.seq, tailLength); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:100:91: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 100 | else tmp = suffix(seqRead.seq, readLength - tailLength); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:100:76: error: there are no arguments to ‘suffix’ that depend on a template parameter, so a declaration of ‘suffix’ must be available [-Wtemplate-body] 100 | else tmp = suffix(seqRead.seq, readLength - tailLength); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:105:33: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’? [-Wtemplate-body] 105 | TAlign align; | ^~~~~~ | SeqAlign /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:106:56: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 106 | appendValue(alignments.aset, align); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:106:33: error: there are no arguments to ‘appendValue’ that depend on a template parameter, so a declaration of ‘appendValue’ must be available [-Wtemplate-body] 106 | appendValue(alignments.aset, align); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:107:56: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 107 | resize(rows(alignments.aset[idxAl]), 2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:107:40: error: there are no arguments to ‘rows’ that depend on a template parameter, so a declaration of ‘rows’ must be available [-Wtemplate-body] 107 | resize(rows(alignments.aset[idxAl]), 2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:109:61: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 109 | assignSource(row(alignments.aset[idxAl], 0), *rseq); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:109:46: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 109 | assignSource(row(alignments.aset[idxAl], 0), *rseq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:110:61: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 110 | assignSource(row(alignments.aset[idxAl], 1), *qseq); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:110:46: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 110 | assignSource(row(alignments.aset[idxAl], 1), *qseq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:133:65: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘seq’ [-Wtemplate-body] 133 | a.queryLength = length(m_queries->at(i).seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:133:41: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 133 | a.queryLength = length(m_queries->at(i).seq); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:147:74: error: request for member ‘pairOverlap’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 147 | if(! m_isBarcoding && m_poMode == PON && seqRead.pairOverlap && | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:181:57: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 181 | seqRead.seq = ""; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:182:79: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 182 | if(m_format == FASTQ) seqRead.qual = ""; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:206:63: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 206 | erase(seqRead.seq, 0, rCutPos); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:206:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 206 | erase(seqRead.seq, 0, rCutPos); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:209:63: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 209 | erase(seqRead.qual, 0, rCutPos); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:209:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 209 | erase(seqRead.qual, 0, rCutPos); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:223:63: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 223 | erase(seqRead.seq, rCutPos, readLength); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:223:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 223 | erase(seqRead.seq, rCutPos, readLength); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:226:63: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 226 | erase(seqRead.qual, rCutPos, readLength); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:226:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 226 | erase(seqRead.qual, rCutPos, readLength); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:236:87: error: request for member ‘rmAdapter’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 236 | if(! m_queries->at(qIndex).rcAdapter) seqRead.rmAdapter = true; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:237:87: error: request for member ‘rmAdapterRC’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 237 | else seqRead.rmAdapterRC = true; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:247:56: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 247 | append(seqRead.id, "_Flexbar_removal"); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:247:41: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 247 | append(seqRead.id, "_Flexbar_removal"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:250:64: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 250 | append(seqRead.id, "_"); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:250:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 250 | append(seqRead.id, "_"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:251:64: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 251 | append(seqRead.id, m_queries->at(qIndex).id); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:251:90: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 251 | append(seqRead.id, m_queries->at(qIndex).id); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:251:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 251 | append(seqRead.id, m_queries->at(qIndex).id); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:263:48: error: request for member ‘umi’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 263 | append(seqRead.umi, "_"); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:263:33: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 263 | append(seqRead.umi, "_"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:264:48: error: request for member ‘umi’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 264 | append(seqRead.umi, am.umiTag); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:279:85: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 279 | s << " query id " << m_queries->at(qIndex).id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:281:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 281 | << " read id " << seqRead.id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:289:79: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 289 | s << " remaining read " << seqRead.seq << "\n"; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:292:79: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 292 | s << " remaining qual " << seqRead.qual << "\n"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:297:46: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 297 | s << seqRead.id << "\t" << m_queries->at(qIndex).id << "\t" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:297:85: error: ‘using tbb::detail::d1::concurrent_vector::value_type = struct flexbar::TBar’ {aka ‘struct flexbar::TBar’} has no member named ‘id’ [-Wtemplate-body] 297 | s << seqRead.id << "\t" << m_queries->at(qIndex).id << "\t" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:304:54: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 304 | << "read id " << seqRead.id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlign.h:305:54: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 305 | << "read seq " << seqRead.seq << "\n\n" << endl; | ^~~ In file included from /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:7: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h: In member function ‘void SeqAlignPair::alignSeqReadPair(flexbar::TSeqRead*, flexbar::TSeqRead*, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:60:50: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 60 | int readLength = length(seqRead.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:60:35: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 60 | int readLength = length(seqRead.seq); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:61:51: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 61 | int readLength2 = length(seqRead2.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:61:35: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 61 | int readLength2 = length(seqRead2.seq); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:73:59: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 73 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:73:40: error: there are no arguments to ‘reserve’ that depend on a template parameter, so a declaration of ‘reserve’ must be available [-Wtemplate-body] 73 | if(idxAl == 0) reserve(alignments.aset, m_bundleSize); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:75:51: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 75 | TSeqStr rcSeq2 = seqRead2.seq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:76:32: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 76 | seqan::reverseComplement(rcSeq2); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:78:25: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’? [-Wtemplate-body] 78 | TAlign align; | ^~~~~~ | SeqAlign /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:79:48: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 79 | appendValue(alignments.aset, align); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:79:25: error: there are no arguments to ‘appendValue’ that depend on a template parameter, so a declaration of ‘appendValue’ must be available [-Wtemplate-body] 79 | appendValue(alignments.aset, align); | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:80:48: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 80 | resize(rows(alignments.aset[idxAl]), 2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:80:32: error: there are no arguments to ‘rows’ that depend on a template parameter, so a declaration of ‘rows’ must be available [-Wtemplate-body] 80 | resize(rows(alignments.aset[idxAl]), 2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:82:53: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:82:38: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:82:78: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 82 | assignSource(row(alignments.aset[idxAl], 0), seqRead.seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:83:53: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 83 | assignSource(row(alignments.aset[idxAl], 1), rcSeq2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:83:38: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 83 | assignSource(row(alignments.aset[idxAl], 1), rcSeq2); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:105:42: error: request for member ‘pairOverlap’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 105 | seqRead2.pairOverlap = true; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:110:56: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 110 | erase(seqRead2.seq, rCutPos, readLength2); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:110:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 110 | erase(seqRead2.seq, rCutPos, readLength2); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:113:56: error: request for member ‘qual’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 113 | erase(seqRead2.qual, rCutPos, readLength2); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:113:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 113 | erase(seqRead2.qual, rCutPos, readLength2); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:117:50: error: request for member ‘poRemoval’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 117 | seqRead2.poRemoval = true; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:119:72: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 119 | if(m_writeTag) append(seqRead2.id, "_Flexbar_removal_PO"); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:119:56: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 119 | if(m_writeTag) append(seqRead2.id, "_Flexbar_removal_PO"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:125:41: error: request for member ‘pairOverlap’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 125 | seqRead.pairOverlap = true; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:130:55: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 130 | erase(seqRead.seq, rCutPos, readLength); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:130:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 130 | erase(seqRead.seq, rCutPos, readLength); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:133:55: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 133 | erase(seqRead.qual, rCutPos, readLength); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:133:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 133 | erase(seqRead.qual, rCutPos, readLength); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:137:49: error: request for member ‘poRemoval’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 137 | seqRead.poRemoval = true; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:139:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 139 | if(m_writeTag) append(seqRead.id, "_Flexbar_removal_PO"); | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:139:56: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 139 | if(m_writeTag) append(seqRead.id, "_Flexbar_removal_PO"); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:154:71: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 154 | s << " read id " << seqRead.id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:156:72: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 156 | << " read2 id " << seqRead2.id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:162:71: error: request for member ‘seq’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 162 | << " remaining read " << seqRead.seq << "\n"; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:165:71: error: request for member ‘qual’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 165 | s << " remaining qual " << seqRead.qual << "\n"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:167:72: error: request for member ‘seq’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 167 | s << " remaining read2 " << seqRead2.seq << "\n"; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:170:72: error: request for member ‘qual’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 170 | s << " remaining qual2 " << seqRead2.qual << "\n"; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:175:46: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 175 | s << seqRead.id << "\t" << seqRead2.id << "\t" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:175:71: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 175 | s << seqRead.id << "\t" << seqRead2.id << "\t" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:182:54: error: request for member ‘id’ in ‘seqRead’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 182 | << "read id " << seqRead.id << "\n" | ^~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignPair.h:183:55: error: request for member ‘id’ in ‘seqRead2’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 183 | << "read2 id " << seqRead2.id << "\n\n" << endl; | ^~ In file included from /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:8: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h: At global scope: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:12:33: error: ‘Value’ in namespace ‘seqan’ does not name a template type [-Wtemplate-body] 12 | typedef typename seqan::Value::Type TChar; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:12:38: error: expected unqualified-id before ‘<’ token [-Wtemplate-body] 12 | typedef typename seqan::Value::Type TChar; | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:13:33: error: ‘Row’ in namespace ‘seqan’ does not name a template type [-Wtemplate-body] 13 | typedef typename seqan::Row::Type TRow; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:13:36: error: expected unqualified-id before ‘<’ token [-Wtemplate-body] 13 | typedef typename seqan::Row::Type TRow; | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:14:33: error: ‘Iterator’ in namespace ‘seqan’ does not name a template type [-Wtemplate-body] 14 | typedef typename seqan::Iterator::Type TRowIterator; | ^~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:14:41: error: expected unqualified-id before ‘<’ token [-Wtemplate-body] 14 | typedef typename seqan::Iterator::Type TRowIterator; | ^ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:18:24: error: ‘Score’ in namespace ‘seqan’ does not name a template type [-Wtemplate-body] 18 | typedef seqan::Score TScoreSimple; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:19:24: error: ‘Score’ in namespace ‘seqan’ does not name a template type [-Wtemplate-body] 19 | typedef seqan::Score > TScoreMatrix; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:22:9: error: ‘TScoreMatrix’ does not name a type [-Wtemplate-body] 22 | TScoreMatrix m_scoreMatrix; | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:142:31: error: ‘TScoreMatrix’ has not been declared [-Wtemplate-body] 142 | void printScoreMatrix(TScoreMatrix &scoreMatrix){ | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h: In constructor ‘SeqAlignAlgo::SeqAlignAlgo(const Options&, int, int, int, bool)’: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:37:17: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’? [-Wtemplate-body] 37 | m_scoreMatrix = TScoreMatrix(gapCost); | ^~~~~~~~~~~~~ | printScoreMatrix /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:37:33: error: there are no arguments to ‘TScoreMatrix’ that depend on a template parameter, so a declaration of ‘TScoreMatrix’ must be available [-Wtemplate-body] 37 | m_scoreMatrix = TScoreMatrix(gapCost); | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:39:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’? [-Wtemplate-body] 39 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~~~~~ | seqan2::ValueSize In file included from /usr/include/seqan/basic/basic_fundamental.h:75, from /usr/include/seqan/basic.h:58, from /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:19: /usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here 47 | template struct ValueSize; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:39:51: error: ‘TChar’ was not declared in this scope [-Wtemplate-body] 39 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:39:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE’? [-Wtemplate-body] 39 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~ | seqan::VALUE /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE’ declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:40:67: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE’? [-Wtemplate-body] 40 | for(unsigned j = 0; j < ValueSize::VALUE; ++j){ | ^~~~~ | seqan::VALUE /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE’ declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:43:42: error: there are no arguments to ‘setScore’ that depend on a template parameter, so a declaration of ‘setScore’ must be available [-Wtemplate-body] 43 | setScore(m_scoreMatrix, TChar(i), TChar(j), match); | ^~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:44:38: error: there are no arguments to ‘setScore’ that depend on a template parameter, so a declaration of ‘setScore’ must be available [-Wtemplate-body] 44 | else setScore(m_scoreMatrix, TChar(i), TChar(j), mismatch); | ^~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h: In member function ‘void SeqAlignAlgo::alignGlobal(TAlignResults&, flexbar::Alignments&, flexbar::ComputeCycle&, unsigned int, flexbar::TrimEnd)’: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:73:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’? [-Wtemplate-body] 73 | AlignConfig ac; | ^~~~~~~~~~~ | seqan2::AlignConfig In file included from /usr/include/seqan/align.h:70: /usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here 93 | class AlignConfig | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:73:70: error: ‘ac’ was not declared in this scope; did you mean ‘a’? [-Wtemplate-body] 73 | AlignConfig ac; | ^~ | a /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:74:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’ [-Wtemplate-body] 74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:74:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:74:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’? [-Wtemplate-body] 74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~ | printScoreMatrix /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:74:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-Wtemplate-body] 74 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:78:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’? [-Wtemplate-body] 78 | AlignConfig ac; | ^~~~~~~~~~~ | seqan2::AlignConfig /usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here 93 | class AlignConfig | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:78:70: error: ‘ac’ was not declared in this scope; did you mean ‘a’? [-Wtemplate-body] 78 | AlignConfig ac; | ^~ | a /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:79:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’ [-Wtemplate-body] 79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:79:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:79:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’? [-Wtemplate-body] 79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~ | printScoreMatrix /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:79:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-Wtemplate-body] 79 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:82:33: error: ‘AlignConfig’ was not declared in this scope; did you mean ‘seqan2::AlignConfig’? [-Wtemplate-body] 82 | AlignConfig ac; | ^~~~~~~~~~~ | seqan2::AlignConfig /usr/include/seqan/align/align_config.h:93:7: note: ‘seqan2::AlignConfig’ declared here 93 | class AlignConfig | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:82:69: error: ‘ac’ was not declared in this scope; did you mean ‘a’? [-Wtemplate-body] 82 | AlignConfig ac; | ^~ | a /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:83:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’ [-Wtemplate-body] 83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:83:81: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:83:87: error: ‘m_scoreMatrix’ was not declared in this scope; did you mean ‘printScoreMatrix’? [-Wtemplate-body] 83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~ | printScoreMatrix /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:83:54: error: there are no arguments to ‘globalAlignment’ that depend on a template parameter, so a declaration of ‘globalAlignment’ must be available [-Wtemplate-body] 83 | alignments.ascores = globalAlignment(alignments.aset, m_scoreMatrix, ac); | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:87:17: error: ‘TAlign’ was not declared in this scope; did you mean ‘SeqAlign’? [-Wtemplate-body] 87 | TAlign &align = alignments.aset[idxAl]; | ^~~~~~ | SeqAlign /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:87:44: error: ‘struct flexbar::Alignments’ has no member named ‘aset’ [-Wtemplate-body] 87 | TAlign &align = alignments.aset[idxAl]; | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:88:44: error: ‘struct flexbar::Alignments’ has no member named ‘ascores’ [-Wtemplate-body] 88 | a.score = alignments.ascores[idxAl]; | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:94:17: error: ‘TRow’ was not declared in this scope [-Wtemplate-body] 94 | TRow &row1 = row(align, 0); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:94:23: error: ‘row1’ was not declared in this scope [-Wtemplate-body] 94 | TRow &row1 = row(align, 0); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:94:30: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 94 | TRow &row1 = row(align, 0); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:95:23: error: ‘row2’ was not declared in this scope [-Wtemplate-body] 95 | TRow &row2 = row(align, 1); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:95:30: error: there are no arguments to ‘row’ that depend on a template parameter, so a declaration of ‘row’ must be available [-Wtemplate-body] 95 | TRow &row2 = row(align, 1); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:97:31: error: there are no arguments to ‘toViewPosition’ that depend on a template parameter, so a declaration of ‘toViewPosition’ must be available [-Wtemplate-body] 97 | a.startPosS = toViewPosition(row1, 0); | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:98:31: error: there are no arguments to ‘toViewPosition’ that depend on a template parameter, so a declaration of ‘toViewPosition’ must be available [-Wtemplate-body] 98 | a.startPosA = toViewPosition(row2, 0); | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:99:59: error: there are no arguments to ‘source’ that depend on a template parameter, so a declaration of ‘source’ must be available [-Wtemplate-body] 99 | a.endPosS = toViewPosition(row1, length(source(row1))); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:100:59: error: there are no arguments to ‘source’ that depend on a template parameter, so a declaration of ‘source’ must be available [-Wtemplate-body] 100 | a.endPosA = toViewPosition(row2, length(source(row2))); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:118:17: error: ‘TRowIterator’ was not declared in this scope [-Wtemplate-body] 118 | TRowIterator it1 = begin(row1); | ^~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:119:30: error: expected ‘;’ before ‘it2’ [-Wtemplate-body] 119 | TRowIterator it2 = begin(row2); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:126:23: error: ‘it1’ was not declared in this scope [-Wtemplate-body] 126 | for(; it1 != end(row1); ++it1){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:129:41: error: there are no arguments to ‘isGap’ that depend on a template parameter, so a declaration of ‘isGap’ must be available [-Wtemplate-body] 129 | if(isGap(it1)) ++a.gapsR; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:130:47: error: ‘it2’ was not declared in this scope [-Wtemplate-body] 130 | else if(isGap(it2)) ++a.gapsA; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:130:41: error: there are no arguments to ‘isGap’ that depend on a template parameter, so a declaration of ‘isGap’ must be available [-Wtemplate-body] 130 | else if(isGap(it2)) ++a.gapsA; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:132:125: error: ‘TChar’ was not declared in this scope [-Wtemplate-body] 132 | else if(m_umiTags && *it2 == 'N') append(a.umiTag, (TChar) *it1); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:135:27: error: ‘it2’ was not declared in this scope [-Wtemplate-body] 135 | ++it2; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h: In member function ‘void SeqAlignAlgo::printScoreMatrix(int&)’: /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:148:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’? [-Wtemplate-body] 148 | for(unsigned i = 0; i < ValueSize::VALUE; ++i) | ^~~~~~~~~ | seqan2::ValueSize /usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here 47 | template struct ValueSize; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:148:51: error: ‘TChar’ was not declared in this scope [-Wtemplate-body] 148 | for(unsigned i = 0; i < ValueSize::VALUE; ++i) | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:148:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE’? [-Wtemplate-body] 148 | for(unsigned i = 0; i < ValueSize::VALUE; ++i) | ^~~~~ | seqan::VALUE /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE’ declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:152:41: error: ‘ValueSize’ was not declared in this scope; did you mean ‘seqan2::ValueSize’? [-Wtemplate-body] 152 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~~~~~ | seqan2::ValueSize /usr/include/seqan/basic/fundamental_comparison.h:47:30: note: ‘seqan2::ValueSize’ declared here 47 | template struct ValueSize; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:152:51: error: ‘TChar’ was not declared in this scope [-Wtemplate-body] 152 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:152:59: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE’? [-Wtemplate-body] 152 | for(unsigned i = 0; i < ValueSize::VALUE; ++i){ | ^~~~~ | seqan::VALUE /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE’ declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:154:67: error: ‘::VALUE’ has not been declared; did you mean ‘seqan::VALUE’? [-Wtemplate-body] 154 | for(unsigned j = 0; j < ValueSize::VALUE; ++j) | ^~~~~ | seqan::VALUE /build/reproducible-path/flexbar-3.5.0/src/FlexbarIO.h:84:22: note: ‘seqan::VALUE’ declared here 84 | char const * FileExtensions::VALUE[1] = { ".dat" }; | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/SeqAlignAlgo.h:155:49: error: there are no arguments to ‘score’ that depend on a template parameter, so a declaration of ‘score’ must be available [-Wtemplate-body] 155 | cout << "\t" << score(scoreMatrix, TChar(i), TChar(j)); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h: In member function ‘void PairedAlign::alignPairedReadToBarcodes(flexbar::TPairedRead*, flexbar::TAlignBundle&, std::vector&, std::vector&, const flexbar::AlignmentMode&) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:109:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 109 | case BARCODE_READ: pRead->barID = m_b1->alignSeqRead(pRead->b, false, alBundle[0], cycle[0], idxAl[0], alMode, m_bTrimEnd, ""); break; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:109:94: error: request for member ‘b’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 109 | case BARCODE_READ: pRead->barID = m_b1->alignSeqRead(pRead->b, false, alBundle[0], cycle[0], idxAl[0], alMode, m_bTrimEnd, ""); break; | ^ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:110:59: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 110 | case WITHIN_READ_REMOVAL2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, true, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, ""); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:110:94: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 110 | case WITHIN_READ_REMOVAL2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, true, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, ""); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:111:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 111 | case WITHIN_READ_REMOVAL: pRead->barID = m_b1->alignSeqRead(pRead->r1, true, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:111:94: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 111 | case WITHIN_READ_REMOVAL: pRead->barID = m_b1->alignSeqRead(pRead->r1, true, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:112:59: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 112 | case WITHIN_READ2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, false, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, ""); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:112:94: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 112 | case WITHIN_READ2: pRead->barID2 = m_b2->alignSeqRead(pRead->r2, false, alBundle[2], cycle[2], idxAl[2], alMode, m_bTrimEnd, ""); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:113:59: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 113 | case WITHIN_READ: pRead->barID = m_b1->alignSeqRead(pRead->r1, false, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:113:94: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 113 | case WITHIN_READ: pRead->barID = m_b1->alignSeqRead(pRead->r1, false, alBundle[1], cycle[1], idxAl[1], alMode, m_bTrimEnd, ""); break; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:117:27: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 117 | if(pRead->barID == 0 || (m_twoBarcodes && pRead->barID2 == 0)){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:117:66: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 117 | if(pRead->barID == 0 || (m_twoBarcodes && pRead->barID2 == 0)){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h: In member function ‘void PairedAlign::alignPairedReadToAdapters(flexbar::TPairedRead*, flexbar::TAlignBundle&, std::vector&, std::vector&, const flexbar::AlignmentMode&, flexbar::TrimEnd) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:132:58: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 132 | if(m_addBarcodeAdapter && pRead->r2 != NULL && pRead->barID2 > 0){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:132:79: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 132 | if(m_addBarcodeAdapter && pRead->r2 != NULL && pRead->barID2 > 0){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:133:69: error: request for member ‘barID2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 133 | addBarcode = m_barcodes2->at(pRead->barID2 - 1).seq; | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:135:56: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 135 | if(m_umiTags && pRead->r2->umi != ""){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:139:90: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 139 | if(addBarcode[i] == 'N' && length(pRead->r2->umi) > umiPos){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:139:76: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 139 | if(addBarcode[i] == 'N' && length(pRead->r2->umi) > umiPos){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:140:80: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 140 | addBarcode[i] = pRead->r2->umi[umiPos++]; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:144:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 144 | seqan::reverseComplement(addBarcode); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:147:51: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 147 | m_a1->alignSeqRead(pRead->r1, true, alBundle[0], cycle[0], idxAl[0], alMode, trimEnd, addBarcode); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:150:27: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 150 | if(pRead->r2 != NULL && m_adapRem != AONE){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:154:58: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 154 | if(m_addBarcodeAdapter && pRead->barID > 0){ | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:155:68: error: request for member ‘barID’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 155 | addBarcode = m_barcodes->at(pRead->barID - 1).seq; | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:157:56: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 157 | if(m_umiTags && pRead->r1->umi != ""){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:161:90: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 161 | if(addBarcode[i] == 'N' && length(pRead->r1->umi) > umiPos){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:161:76: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 161 | if(addBarcode[i] == 'N' && length(pRead->r1->umi) > umiPos){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:162:80: error: request for member ‘r1’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 162 | addBarcode[i] = pRead->r1->umi[umiPos++]; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:166:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 166 | seqan::reverseComplement(addBarcode); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:169:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 169 | if(m_adapRem != NORMAL2) m_a1->alignSeqRead(pRead->r2, true, alBundle[1], cycle[1], idxAl[1], alMode, trimEnd, addBarcode); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:170:76: error: request for member ‘r2’ in ‘pRead->’, which is of non-class type ‘flexbar::TPairedRead’ {aka ‘int’} [-Wtemplate-body] 170 | else m_a2->alignSeqRead(pRead->r2, true, alBundle[1], cycle[1], idxAl[1], alMode, trimEnd, addBarcode); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h: In member function ‘void PairedAlign::trimLeftHPS(flexbar::TSeqRead*) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:181:42: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 181 | if (seqRead->rmAdapter && (m_aTrimEnd == RIGHT || m_aTrimEnd == RTAIL)) return; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:182:42: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 182 | else if(seqRead->rmAdapterRC && (m_arcTrimEnd == RIGHT || m_arcTrimEnd == RTAIL)) return; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:188:51: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 188 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:188:73: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 188 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){ | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:197:77: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 197 | for(unsigned int i = 0; i < length(seqRead->seq); ++i){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:197:61: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 197 | for(unsigned int i = 0; i < length(seqRead->seq); ++i){ | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:199:53: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 199 | if(seqRead->seq[i] != nuc){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:214:56: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 214 | erase(seqRead->seq, 0, cutPos); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:214:41: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 214 | erase(seqRead->seq, 0, cutPos); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:217:64: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 217 | erase(seqRead->qual, 0, cutPos); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:217:49: error: there are no arguments to ‘erase’ that depend on a template parameter, so a declaration of ‘erase’ must be available [-Wtemplate-body] 217 | erase(seqRead->qual, 0, cutPos); | ^~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h: In member function ‘void PairedAlign::trimRightHPS(flexbar::TSeqRead*) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:231:42: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 231 | if (seqRead->rmAdapter && (m_aTrimEnd == LEFT || m_aTrimEnd == LTAIL)) return; | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:232:42: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 232 | else if(seqRead->rmAdapterRC && (m_arcTrimEnd == LEFT || m_arcTrimEnd == LTAIL)) return; | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:238:51: error: request for member ‘rmAdapter’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 238 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){ | ^~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:238:73: error: request for member ‘rmAdapterRC’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 238 | if(! m_htrimAdapterRm || seqRead->rmAdapter || seqRead->rmAdapterRC){ | ^~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:244:71: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 244 | unsigned int seqLen = length(seqRead->seq); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:244:55: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 244 | unsigned int seqLen = length(seqRead->seq); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:250:53: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 250 | if(seqRead->seq[i] != nuc){ | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:265:56: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 265 | erase(seqRead->seq, cutPos, length(seqRead->seq)); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:265:85: error: request for member ‘seq’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 265 | erase(seqRead->seq, cutPos, length(seqRead->seq)); | ^~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:265:69: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 265 | erase(seqRead->seq, cutPos, length(seqRead->seq)); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:268:64: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 268 | erase(seqRead->qual, cutPos, length(seqRead->qual)); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:268:94: error: request for member ‘qual’ in ‘seqRead->’, which is of non-class type ‘flexbar::TSeqRead’ {aka ‘int’} [-Wtemplate-body] 268 | erase(seqRead->qual, cutPos, length(seqRead->qual)); | ^~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:268:78: error: there are no arguments to ‘length’ that depend on a template parameter, so a declaration of ‘length’ must be available [-Wtemplate-body] 268 | erase(seqRead->qual, cutPos, length(seqRead->qual)); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h: In member function ‘flexbar::TPairedReadBundle* PairedAlign::operator()(flexbar::TPairedReadBundle*) const’: /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:285:58: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 285 | prBundle->at(i)->r1->umi = ""; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:287:61: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 287 | if(prBundle->at(i)->r2 != NULL) | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:288:58: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 288 | prBundle->at(i)->r2->umi = ""; | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:334:80: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 334 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:334:101: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 334 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:341:80: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 341 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:341:101: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 341 | m_p->alignSeqReadPair(prBundle->at(i)->r1, prBundle->at(i)->r2, alignments, cycle, idxAl); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:394:65: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:394:90: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:394:41: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 394 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r1->umi); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:396:61: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 396 | if(prBundle->at(i)->r2 != NULL){ | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:397:73: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:397:98: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:397:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 397 | append(prBundle->at(i)->r1->id, prBundle->at(i)->r2->umi); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:398:73: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:398:98: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:398:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 398 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r1->umi); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:399:73: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:399:98: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:399:49: error: there are no arguments to ‘append’ that depend on a template parameter, so a declaration of ‘append’ must be available [-Wtemplate-body] 399 | append(prBundle->at(i)->r2->id, prBundle->at(i)->r2->umi); | ^~~~~~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:407:78: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 407 | trimLeftHPS(prBundle->at(i)->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:409:69: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 409 | if(prBundle->at(i)->r2 != NULL) | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:410:78: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 410 | trimLeftHPS(prBundle->at(i)->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:415:79: error: request for member ‘r1’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 415 | trimRightHPS(prBundle->at(i)->r1); | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:417:69: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 417 | if(prBundle->at(i)->r2 != NULL) | ^~ /build/reproducible-path/flexbar-3.5.0/src/PairedAlign.h:418:79: error: request for member ‘r2’ in ‘i->prBundle->std::vector::at()->’, which is of non-class type ‘int’ [-Wtemplate-body] 418 | trimRightHPS(prBundle->at(i)->r2); | ^~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h: In function ‘void loadAdapters(Options&, bool, bool)’: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:116:37: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 116 | bar.id = "cmdline"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:117:37: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 117 | bar.seq = o.adapterSeq; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:122:40: error: ‘reverseComplement’ is not a member of ‘seqan’; did you mean ‘seqan2::reverseComplement’? [-Wtemplate-body] 122 | seqan::reverseComplement(adapterSeqRC); | ^~~~~~~~~~~~~~~~~ /usr/include/seqan/modifier/modifier_shortcuts.h:334:13: note: ‘seqan2::reverseComplement’ declared here 334 | inline void reverseComplement(TText const & text) | ^~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:125:39: error: ‘struct flexbar::TBar’ has no member named ‘id’ [-Wtemplate-body] 125 | barRC.id = "cmdline_rc"; | ^~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:126:39: error: ‘struct flexbar::TBar’ has no member named ‘seq’ [-Wtemplate-body] 126 | barRC.seq = adapterSeqRC; | ^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h: In function ‘void startComputation(Options&)’: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:33: error: ‘FSeqStr’ was not declared in this scope 371 | loadBarcodesAndAdapters(o); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:42: error: ‘FString’ was not declared in this scope 371 | loadBarcodesAndAdapters(o); | ^~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:50: error: no matching function for call to ‘loadBarcodesAndAdapters<, >(Options&)’ 371 | loadBarcodesAndAdapters(o); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:50: note: there is 1 candidate /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:139:6: note: candidate 1: ‘template void loadBarcodesAndAdapters(Options&)’ 139 | void loadBarcodesAndAdapters(Options &o){ | ^~~~~~~~~~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:139:6: note: template argument deduction/substitution failed: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:50: error: template argument 1 is invalid 371 | loadBarcodesAndAdapters(o); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:371:50: error: template argument 2 is invalid /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:376:58: error: no matching function for call to ‘startProcessing(Options&)’ 376 | startProcessing(o); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:376:58: note: there is 1 candidate /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: candidate 1: ‘template void startProcessing(Options&)’ 224 | void startProcessing(Options &o){ | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: template argument deduction/substitution failed: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:388:58: error: no matching function for call to ‘startProcessing(Options&)’ 388 | startProcessing(o); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:388:58: note: there is 1 candidate /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: candidate 1: ‘template void startProcessing(Options&)’ 224 | void startProcessing(Options &o){ | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: template argument deduction/substitution failed: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:398:50: error: no matching function for call to ‘startProcessing(Options&)’ 398 | startProcessing(o); | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:398:50: note: there is 1 candidate /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: candidate 1: ‘template void startProcessing(Options&)’ 224 | void startProcessing(Options &o){ | ^~~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.h:224:6: note: template argument deduction/substitution failed: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp: In function ‘int main(int, const char**)’: /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp:35:9: error: ‘ArgumentParser’ was not declared in this scope; did you mean ‘seqan2::ArgumentParser’? 35 | ArgumentParser parser("flexbar"); | ^~~~~~~~~~~~~~ | seqan2::ArgumentParser /usr/include/seqan/arg_parse/argument_parser.h:152:7: note: ‘seqan2::ArgumentParser’ declared here 152 | class ArgumentParser | ^~~~~~~~~~~~~~ /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp:37:23: error: ‘parser’ was not declared in this scope; did you mean ‘pause’? 37 | defineOptions(parser, version, date); | ^~~~~~ | pause /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp:37:9: error: ‘defineOptions’ was not declared in this scope; did you mean ‘initOptions’? 37 | defineOptions(parser, version, date); | ^~~~~~~~~~~~~ | initOptions /build/reproducible-path/flexbar-3.5.0/src/Flexbar.cpp:38:9: error: ‘parseCmdLine’ was not declared in this scope 38 | parseCmdLine(parser, version, argc, argv); | ^~~~~~~~~~~~ make[3]: *** [src/CMakeFiles/flexbar.dir/build.make:82: src/CMakeFiles/flexbar.dir/Flexbar.cpp.o] Error 1 make[3]: Leaving directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' make[2]: *** [CMakeFiles/Makefile2:109: src/CMakeFiles/flexbar.dir/all] Error 2 make[2]: Leaving directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' make[1]: *** [Makefile:94: all] Error 2 make[1]: Leaving directory '/build/reproducible-path/flexbar-3.5.0/obj-x86_64-linux-gnu' dh_auto_build: error: cd obj-x86_64-linux-gnu && make -j1 INSTALL="install --strip-program=true" VERBOSE=1 returned exit code 2 make: *** [debian/rules:8: binary-arch] Error 25 dpkg-buildpackage: error: debian/rules binary-arch subprocess failed with exit status 2 -------------------------------------------------------------------------------- Build finished at 2026-02-20T20:02:46Z +------------------------------------------------------------------------------+ | Finished Timed Build Commands Fri, 20 Feb 2026 20:02:46 +0000 | +------------------------------------------------------------------------------+ rm -Rf /build/reproducible-path/flexbar-3.5.0/ ---------------------------------------------- I: Finished running 'rm -Rf /build/reproducible-path/flexbar-3.5.0/'. Finished processing commands. -------------------------------------------------------------------------------- Finished -------- +------------------------------------------------------------------------------+ | Cleanup Fri, 20 Feb 2026 20:02:47 +0000 | +------------------------------------------------------------------------------+ Purging /build/reproducible-path Not cleaning session: cloned chroot in use E: Build failure (dpkg-buildpackage died with exit 2) +------------------------------------------------------------------------------+ | Summary Fri, 20 Feb 2026 20:02:50 +0000 | +------------------------------------------------------------------------------+ Build Architecture: arm64 Build Profiles: cross nocheck Build Type: any Build-Space: n/a Build-Time: 35 Distribution: unstable Fail-Stage: build Foreign Architectures: amd64 Host Architecture: amd64 Install-Time: 56 Job: flexbar_1:3.5.0-7 Machine Architecture: arm64 Package: flexbar Package-Time: 146 Source-Version: 1:3.5.0-7 Space: n/a Status: attempted Version: 1:3.5.0-7 -------------------------------------------------------------------------------- Finished at 2026-02-20T20:02:46Z Build needed 00:02:26, no disk space